ID: 1057514270

View in Genome Browser
Species Human (GRCh38)
Location 9:95708224-95708246
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057514265_1057514270 12 Left 1057514265 9:95708189-95708211 CCTCCTAAAGCTGAGAATTACTC No data
Right 1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG No data
1057514264_1057514270 19 Left 1057514264 9:95708182-95708204 CCGCTGGCCTCCTAAAGCTGAGA No data
Right 1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG No data
1057514261_1057514270 22 Left 1057514261 9:95708179-95708201 CCCCCGCTGGCCTCCTAAAGCTG No data
Right 1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG No data
1057514262_1057514270 21 Left 1057514262 9:95708180-95708202 CCCCGCTGGCCTCCTAAAGCTGA No data
Right 1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG No data
1057514266_1057514270 9 Left 1057514266 9:95708192-95708214 CCTAAAGCTGAGAATTACTCTTC No data
Right 1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG No data
1057514263_1057514270 20 Left 1057514263 9:95708181-95708203 CCCGCTGGCCTCCTAAAGCTGAG No data
Right 1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057514270 Original CRISPR CTAAGGTTGACCCTCCATGT GGG Intergenic