ID: 1057517858

View in Genome Browser
Species Human (GRCh38)
Location 9:95737129-95737151
Sequence TCCAGAGCCTCGAGGGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057517850_1057517858 15 Left 1057517850 9:95737091-95737113 CCCAGGAAGCCAGGACAGGGCTG No data
Right 1057517858 9:95737129-95737151 TCCAGAGCCTCGAGGGCAAGAGG No data
1057517845_1057517858 30 Left 1057517845 9:95737076-95737098 CCTGCTCGGCAACCTCCCAGGAA No data
Right 1057517858 9:95737129-95737151 TCCAGAGCCTCGAGGGCAAGAGG No data
1057517848_1057517858 18 Left 1057517848 9:95737088-95737110 CCTCCCAGGAAGCCAGGACAGGG No data
Right 1057517858 9:95737129-95737151 TCCAGAGCCTCGAGGGCAAGAGG No data
1057517851_1057517858 14 Left 1057517851 9:95737092-95737114 CCAGGAAGCCAGGACAGGGCTGG No data
Right 1057517858 9:95737129-95737151 TCCAGAGCCTCGAGGGCAAGAGG No data
1057517853_1057517858 6 Left 1057517853 9:95737100-95737122 CCAGGACAGGGCTGGCTGTTCAG No data
Right 1057517858 9:95737129-95737151 TCCAGAGCCTCGAGGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057517858 Original CRISPR TCCAGAGCCTCGAGGGCAAG AGG Intergenic
No off target data available for this crispr