ID: 1057518819

View in Genome Browser
Species Human (GRCh38)
Location 9:95744489-95744511
Sequence ACCTCGTTGCCTCCCTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057518819_1057518821 -10 Left 1057518819 9:95744489-95744511 CCAGAAGAGGGAGGCAACGAGGT No data
Right 1057518821 9:95744502-95744524 GCAACGAGGTCAGTGGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057518819 Original CRISPR ACCTCGTTGCCTCCCTCTTC TGG (reversed) Intergenic
No off target data available for this crispr