ID: 1057522167

View in Genome Browser
Species Human (GRCh38)
Location 9:95768740-95768762
Sequence CCAAAGTTCTGGAGTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057522167_1057522172 15 Left 1057522167 9:95768740-95768762 CCTCCCAGACTCCAGAACTTTGG No data
Right 1057522172 9:95768778-95768800 TTTATAAGCCACCCAGTCTATGG 0: 136
1: 574
2: 1514
3: 4168
4: 16296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057522167 Original CRISPR CCAAAGTTCTGGAGTCTGGG AGG (reversed) Intergenic
No off target data available for this crispr