ID: 1057522317

View in Genome Browser
Species Human (GRCh38)
Location 9:95769768-95769790
Sequence TAACCTTGCTTGTTGGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057522313_1057522317 0 Left 1057522313 9:95769745-95769767 CCAGTCAGAGGATGGATTCTCCA No data
Right 1057522317 9:95769768-95769790 TAACCTTGCTTGTTGGTTCAGGG No data
1057522312_1057522317 5 Left 1057522312 9:95769740-95769762 CCTGGCCAGTCAGAGGATGGATT No data
Right 1057522317 9:95769768-95769790 TAACCTTGCTTGTTGGTTCAGGG No data
1057522309_1057522317 11 Left 1057522309 9:95769734-95769756 CCCAGGCCTGGCCAGTCAGAGGA No data
Right 1057522317 9:95769768-95769790 TAACCTTGCTTGTTGGTTCAGGG No data
1057522310_1057522317 10 Left 1057522310 9:95769735-95769757 CCAGGCCTGGCCAGTCAGAGGAT No data
Right 1057522317 9:95769768-95769790 TAACCTTGCTTGTTGGTTCAGGG No data
1057522307_1057522317 16 Left 1057522307 9:95769729-95769751 CCTGACCCAGGCCTGGCCAGTCA No data
Right 1057522317 9:95769768-95769790 TAACCTTGCTTGTTGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057522317 Original CRISPR TAACCTTGCTTGTTGGTTCA GGG Intergenic