ID: 1057528719

View in Genome Browser
Species Human (GRCh38)
Location 9:95825321-95825343
Sequence CTGTGCTTCCCCAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057528719_1057528723 -5 Left 1057528719 9:95825321-95825343 CCTGCTTCCCTGGGGAAGCACAG No data
Right 1057528723 9:95825339-95825361 CACAGGCACATCAGTGTGCTCGG No data
1057528719_1057528727 23 Left 1057528719 9:95825321-95825343 CCTGCTTCCCTGGGGAAGCACAG No data
Right 1057528727 9:95825367-95825389 TTGCAGAGAGCTGTCCCCTAGGG No data
1057528719_1057528725 -3 Left 1057528719 9:95825321-95825343 CCTGCTTCCCTGGGGAAGCACAG No data
Right 1057528725 9:95825341-95825363 CAGGCACATCAGTGTGCTCGGGG No data
1057528719_1057528726 22 Left 1057528719 9:95825321-95825343 CCTGCTTCCCTGGGGAAGCACAG No data
Right 1057528726 9:95825366-95825388 TTTGCAGAGAGCTGTCCCCTAGG No data
1057528719_1057528724 -4 Left 1057528719 9:95825321-95825343 CCTGCTTCCCTGGGGAAGCACAG No data
Right 1057528724 9:95825340-95825362 ACAGGCACATCAGTGTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057528719 Original CRISPR CTGTGCTTCCCCAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr