ID: 1057534162

View in Genome Browser
Species Human (GRCh38)
Location 9:95882373-95882395
Sequence AAAGCTAAAGACCCTGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057534162_1057534163 -4 Left 1057534162 9:95882373-95882395 CCTGCTACAGGGTCTTTAGCTTT 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1057534163 9:95882392-95882414 CTTTCCTTAGATTTTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057534162 Original CRISPR AAAGCTAAAGACCCTGTAGC AGG (reversed) Intronic
902879471 1:19361560-19361582 AAAGCCATAAACCATGTAGCGGG - Intronic
903661666 1:24982330-24982352 AAAGCCAGAGACCCTCTCGCTGG - Intergenic
908399695 1:63759487-63759509 AAAGCTAAAAAGCCTGTAAGTGG - Intergenic
914801688 1:150967038-150967060 AAATCTAGAGACCCTGGTGCAGG - Intronic
917412146 1:174769869-174769891 AAAGCAAAAGACCTTGAAACTGG + Intronic
917487731 1:175469946-175469968 AATGCAAAAGACCCTTTAGAGGG + Intronic
920277605 1:204819080-204819102 CCAGCCAAAGGCCCTGTAGCAGG + Intergenic
921298645 1:213728507-213728529 AAAGGTGAAGATCCTGTAGCGGG - Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
924522912 1:244821056-244821078 AATGCAAAAGACCCAGTAGTTGG + Intergenic
1063872262 10:10430927-10430949 GATGCTAAAGACCCTGTGGGTGG + Intergenic
1064337720 10:14458697-14458719 AAAGCTAAATTCCATGAAGCAGG + Intronic
1065365269 10:24929161-24929183 AAAACTAAAGACACTGAACCTGG + Intronic
1065884016 10:30060933-30060955 AAAGCTAAACACACTATTGCTGG + Intronic
1066209937 10:33226701-33226723 ACAGGTAAAGACCAGGTAGCAGG - Intronic
1070571235 10:77640349-77640371 AAAGCTATAGATCCTGCAGTTGG - Intergenic
1079274499 11:19021917-19021939 CAAGAAAAAGGCCCTGTAGCAGG - Intergenic
1081049814 11:38324425-38324447 TAAGCTGCTGACCCTGTAGCTGG + Intergenic
1083333274 11:61908987-61909009 GAAGCTGAAGACCCTGGAGGTGG + Intronic
1083529964 11:63411142-63411164 AAAGCTAAGGAACCTGAAGTCGG + Intergenic
1085077134 11:73601197-73601219 GAAGCTAGAGACGCTGCAGCGGG - Intergenic
1085466057 11:76724057-76724079 ACATCTAAGGACCCTGTTGCAGG - Intergenic
1086486345 11:87306697-87306719 AAAACTAAAGAACTTGCAGCAGG - Intronic
1088495546 11:110428406-110428428 TATGTTCAAGACCCTGTAGCTGG + Intergenic
1089737681 11:120561344-120561366 AAAGCTCAAAGCCCAGTAGCAGG - Intronic
1090854736 11:130601686-130601708 CCAGCTAAAGGCCATGTAGCTGG + Intergenic
1091754204 12:3041122-3041144 AAATCAAAGGACCCTGAAGCGGG + Intergenic
1099668666 12:85662118-85662140 AAAGAAAAAGATCATGTAGCTGG - Intergenic
1100328962 12:93568336-93568358 AAATACAAAGACCCTGAAGCAGG + Intergenic
1104709318 12:130974241-130974263 CAAATTAAAGTCCCTGTAGCAGG + Intronic
1108338254 13:49469229-49469251 AAAGATAAAAACCTTGTGGCTGG + Intronic
1108723748 13:53158994-53159016 AAAGCTAAATACTATGTACCTGG - Intergenic
1108886246 13:55185911-55185933 CAAACTAAAGACCCAGTAGAAGG + Intergenic
1109784427 13:67155902-67155924 CAAGCCAAAAACGCTGTAGCAGG - Intronic
1110653459 13:77970307-77970329 GAAGCTATAGAACGTGTAGCAGG + Intergenic
1115351047 14:32396264-32396286 AAAGCTAAACACCATGAGGCTGG - Intronic
1116946407 14:50839295-50839317 AAAGCAAAATACACTGAAGCTGG + Intergenic
1117523748 14:56576983-56577005 AATGTTTAAGACACTGTAGCAGG + Intronic
1117879994 14:60303905-60303927 ATAGCTAAGTACCATGTAGCTGG + Intergenic
1123675193 15:22703743-22703765 ACATATAATGACCCTGTAGCAGG - Intergenic
1129206723 15:74041602-74041624 AAAGCTGATGAGCCTGGAGCAGG + Intronic
1133477046 16:6133774-6133796 ACAGGCAAAGACCCTGTGGCAGG - Intronic
1133881434 16:9786314-9786336 AAAACTAAGGACCCAGAAGCAGG - Intronic
1139564976 16:67768815-67768837 AAAGCAAATGGCCCTGTATCAGG - Intronic
1141752289 16:85966839-85966861 AAAGCCCAACACACTGTAGCAGG - Intergenic
1149307653 17:55364590-55364612 AGAGATAAAGACCCTGAACCAGG + Intergenic
1149468914 17:56900650-56900672 AAACACAAAGGCCCTGTAGCAGG + Intronic
1155916889 18:31565946-31565968 AAAGCTATAAATCCTGGAGCAGG - Intergenic
1156232410 18:35166580-35166602 AAACCTTAACAACCTGTAGCTGG - Intergenic
1166650651 19:44571961-44571983 AAAACCAAAGACCCTATAGAGGG - Intergenic
1168163572 19:54529984-54530006 AAAGATAAAGTAACTGTAGCTGG + Intergenic
1168613768 19:57821390-57821412 CAAGCTAGAGAACCTGTAGATGG - Intronic
1168617755 19:57852095-57852117 CAAGCTAGAGAACCTGTAGATGG - Intronic
926051816 2:9749950-9749972 AAAGCGAAAGCCAATGTAGCAGG - Intergenic
927297374 2:21470064-21470086 AATGCTACAGCCCCTGGAGCTGG + Intergenic
927297437 2:21470697-21470719 AATCCTACAGCCCCTGTAGCTGG - Intergenic
928010857 2:27606217-27606239 AAAGATAAAGAACTTGTATCCGG - Intronic
929244914 2:39690715-39690737 AAAAATAAAGTCCCAGTAGCTGG + Intronic
931792723 2:65679343-65679365 AAAGTTAAGAACCCTTTAGCAGG + Intergenic
931990574 2:67785906-67785928 TAAGCTAGAGACCTTGTAGAAGG - Intergenic
935794775 2:106630589-106630611 AAGGCTGAAGACCCTGGAGCTGG + Intergenic
939943230 2:148377175-148377197 AAAGCTGAAGAACCTGGAGTCGG + Intronic
1170309485 20:14976522-14976544 TAAGCTAAAGACCTTGCAGTGGG - Intronic
1171324375 20:24278193-24278215 AAAGATAAAGACATTGTTGCAGG + Intergenic
1175201850 20:57283510-57283532 AAAGCTGAACACCCAGAAGCTGG + Intergenic
1176897070 21:14392698-14392720 AAAGATAAAGTCCCTCTAGAGGG - Intergenic
1178740922 21:35200308-35200330 GAAGCTAAAGAACCTGTAAAGGG - Intronic
951295485 3:20928410-20928432 AAAGCCAAAGGCTCTGTAGAAGG - Intergenic
952220439 3:31318799-31318821 AAAGCAAAAGAACATGAAGCAGG - Intergenic
952445256 3:33375332-33375354 AAAGGCAGAGAGCCTGTAGCCGG - Exonic
959452516 3:106521207-106521229 AAAGCTAAAGTTCATGTGGCAGG + Intergenic
961825814 3:129598517-129598539 ACAGCTACAGGCCCGGTAGCAGG + Intronic
962549423 3:136474718-136474740 AAAGCTGAAGTGCCTGTGGCAGG + Intronic
962756718 3:138470377-138470399 AAATATAAAGACCCTTTTGCAGG - Intronic
963212887 3:142714202-142714224 AAATGTAAAGAACCTGAAGCAGG + Intergenic
966600452 3:181769876-181769898 AAAGATCAAGACCCTGTCTCTGG + Intergenic
967576343 3:191098248-191098270 AAAGTTAAATATCCTGTAACTGG + Intergenic
981217741 4:142191321-142191343 AAAGCCAAAGAACCTGGAACAGG + Intronic
983765306 4:171473482-171473504 AAAGTTACAGACCCTGGTGCTGG - Intergenic
986093415 5:4533503-4533525 AAATCTAAAGTCCCTTAAGCGGG - Intergenic
990719353 5:58676200-58676222 AACTCTAAAGAACCTATAGCTGG + Intronic
992636742 5:78731826-78731848 AAATCTAAAGACCCCATAGTGGG - Intronic
993216541 5:85030570-85030592 AAAGCTATACAGCCTGAAGCAGG - Intergenic
996887961 5:128381684-128381706 AAAGTTAAAGCCCCAGCAGCAGG - Intronic
1001383861 5:171321848-171321870 AAAGCAAAAGACCTTGAACCTGG + Intergenic
1002964437 6:1949039-1949061 AAAGTGAAAGACCCTGTTGGAGG - Intronic
1007229232 6:40336845-40336867 AGAGCTGAAGACCCTGGGGCAGG + Intergenic
1007280626 6:40709744-40709766 AAGGCTAAAGGACCTGTATCTGG + Intergenic
1012992701 6:105942211-105942233 AAATCAAAAGACTCTGAAGCAGG - Intergenic
1014174082 6:118312669-118312691 AAAGAAAAAAACGCTGTAGCAGG + Intronic
1014501704 6:122198826-122198848 TAAGCCCAAGACCATGTAGCTGG - Intergenic
1015058872 6:128938139-128938161 AAAGCTAAATACCTTGTAAGTGG - Intronic
1017856357 6:158352694-158352716 AAAGTTAAAGAACCAGTATCGGG - Intronic
1019269902 7:140991-141013 TAGGCTACAGATCCTGTAGCAGG + Intergenic
1019491872 7:1317992-1318014 ATAGATAGAGACCCTGCAGCTGG + Intergenic
1019677727 7:2324992-2325014 AAAAATAAATAGCCTGTAGCTGG - Intronic
1024035068 7:45501025-45501047 AAAGCTAAAAAGCCTCTTGCTGG + Intergenic
1024381080 7:48696814-48696836 AAATTCAAAGACCCTGTATCAGG - Intergenic
1027256289 7:76432820-76432842 ATAGCTGAGGACCCTGTAGTGGG + Intronic
1028682638 7:93554631-93554653 AAAGTTTAAGACCCATTAGCAGG + Intronic
1029152249 7:98489327-98489349 ATAGCAAAAGACCCTGTTTCTGG + Intergenic
1032135332 7:129271607-129271629 AAAGCTAAAAACCCGGGTGCGGG + Intronic
1035596921 8:865813-865835 CAAGCTCAGGACCCTGTAGCTGG - Intergenic
1037400345 8:18489414-18489436 AAAGACAAAGACCCTGTAATTGG + Intergenic
1038289239 8:26234200-26234222 ATAGCTGTAGACACTGTAGCAGG - Intergenic
1039713052 8:40077555-40077577 AAAGATAAAGATCCTCTAGTTGG + Intergenic
1044383161 8:91557931-91557953 AAATCTAAACTTCCTGTAGCTGG - Intergenic
1044822616 8:96165494-96165516 AAAGCTAAAGACTCTGCTTCAGG + Intergenic
1045401829 8:101826880-101826902 AAATCTAAAGACAATGTAGTAGG + Intronic
1048633296 8:136268131-136268153 AAAGTTAAAAACCCAGTTGCAGG + Intergenic
1052434537 9:28409231-28409253 CAAGCAAATGATCCTGTAGCGGG - Intronic
1057534162 9:95882373-95882395 AAAGCTAAAGACCCTGTAGCAGG - Intronic
1057585021 9:96321227-96321249 AGAGCTAAAGAGTCTGCAGCAGG - Exonic
1061556666 9:131374257-131374279 AAAACTAAACACACTGTGGCTGG + Intergenic
1190423375 X:50308742-50308764 AAAGCTACAGCCCCTGCAGGAGG + Exonic
1191594400 X:62926335-62926357 AAAACTAAAGATTCTGTAGGTGG + Intergenic
1199763030 X:150919739-150919761 AAAGGAAAAGACCTTTTAGCAGG - Intergenic