ID: 1057536973

View in Genome Browser
Species Human (GRCh38)
Location 9:95919649-95919671
Sequence ACAACGACGGTATCTTCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057536973_1057536979 29 Left 1057536973 9:95919649-95919671 CCATTTGAAGATACCGTCGTTGT No data
Right 1057536979 9:95919701-95919723 CTGGAATAGTAAATTCCTGCTGG No data
1057536973_1057536975 10 Left 1057536973 9:95919649-95919671 CCATTTGAAGATACCGTCGTTGT No data
Right 1057536975 9:95919682-95919704 GCCATGAAAGCCATCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057536973 Original CRISPR ACAACGACGGTATCTTCAAA TGG (reversed) Intronic