ID: 1057536974

View in Genome Browser
Species Human (GRCh38)
Location 9:95919662-95919684
Sequence GGCTTTTTCTATAACAACGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057536974_1057536979 16 Left 1057536974 9:95919662-95919684 CCGTCGTTGTTATAGAAAAAGCC No data
Right 1057536979 9:95919701-95919723 CTGGAATAGTAAATTCCTGCTGG No data
1057536974_1057536975 -3 Left 1057536974 9:95919662-95919684 CCGTCGTTGTTATAGAAAAAGCC No data
Right 1057536975 9:95919682-95919704 GCCATGAAAGCCATCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057536974 Original CRISPR GGCTTTTTCTATAACAACGA CGG (reversed) Intronic