ID: 1057536974 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:95919662-95919684 |
| Sequence | GGCTTTTTCTATAACAACGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1057536974_1057536979 | 16 | Left | 1057536974 | 9:95919662-95919684 | CCGTCGTTGTTATAGAAAAAGCC | No data | ||
| Right | 1057536979 | 9:95919701-95919723 | CTGGAATAGTAAATTCCTGCTGG | No data | ||||
| 1057536974_1057536975 | -3 | Left | 1057536974 | 9:95919662-95919684 | CCGTCGTTGTTATAGAAAAAGCC | No data | ||
| Right | 1057536975 | 9:95919682-95919704 | GCCATGAAAGCCATCATTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1057536974 | Original CRISPR | GGCTTTTTCTATAACAACGA CGG (reversed) | Intronic | ||