ID: 1057536975

View in Genome Browser
Species Human (GRCh38)
Location 9:95919682-95919704
Sequence GCCATGAAAGCCATCATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057536973_1057536975 10 Left 1057536973 9:95919649-95919671 CCATTTGAAGATACCGTCGTTGT 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1057536975 9:95919682-95919704 GCCATGAAAGCCATCATTCCTGG No data
1057536974_1057536975 -3 Left 1057536974 9:95919662-95919684 CCGTCGTTGTTATAGAAAAAGCC 0: 3
1: 17
2: 53
3: 76
4: 131
Right 1057536975 9:95919682-95919704 GCCATGAAAGCCATCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057536975 Original CRISPR GCCATGAAAGCCATCATTCC TGG Intronic
No off target data available for this crispr