ID: 1057536979

View in Genome Browser
Species Human (GRCh38)
Location 9:95919701-95919723
Sequence CTGGAATAGTAAATTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057536973_1057536979 29 Left 1057536973 9:95919649-95919671 CCATTTGAAGATACCGTCGTTGT No data
Right 1057536979 9:95919701-95919723 CTGGAATAGTAAATTCCTGCTGG No data
1057536976_1057536979 -5 Left 1057536976 9:95919683-95919705 CCATGAAAGCCATCATTCCTGGA No data
Right 1057536979 9:95919701-95919723 CTGGAATAGTAAATTCCTGCTGG No data
1057536974_1057536979 16 Left 1057536974 9:95919662-95919684 CCGTCGTTGTTATAGAAAAAGCC No data
Right 1057536979 9:95919701-95919723 CTGGAATAGTAAATTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057536979 Original CRISPR CTGGAATAGTAAATTCCTGC TGG Intronic