ID: 1057546053

View in Genome Browser
Species Human (GRCh38)
Location 9:96021198-96021220
Sequence GCCCCGCCGCGGGTGCCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057546053_1057546057 -6 Left 1057546053 9:96021198-96021220 CCGAAGGGCACCCGCGGCGGGGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1057546057 9:96021215-96021237 CGGGGCCCACAACTCGAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1057546053_1057546064 28 Left 1057546053 9:96021198-96021220 CCGAAGGGCACCCGCGGCGGGGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1057546064 9:96021249-96021271 GCAACCCGTTCCTCCGAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 18
1057546053_1057546056 -7 Left 1057546053 9:96021198-96021220 CCGAAGGGCACCCGCGGCGGGGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1057546056 9:96021214-96021236 GCGGGGCCCACAACTCGAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057546053 Original CRISPR GCCCCGCCGCGGGTGCCCTT CGG (reversed) Intergenic