ID: 1057547920

View in Genome Browser
Species Human (GRCh38)
Location 9:96031873-96031895
Sequence CTGTTTACACGGACTCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057547920_1057547928 30 Left 1057547920 9:96031873-96031895 CCGTCCTGAGTCCGTGTAAACAG No data
Right 1057547928 9:96031926-96031948 AATTTAGATCCCACTGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057547920 Original CRISPR CTGTTTACACGGACTCAGGA CGG (reversed) Intergenic
No off target data available for this crispr