ID: 1057547976

View in Genome Browser
Species Human (GRCh38)
Location 9:96032189-96032211
Sequence CTGATGAAGGGAGGTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057547976_1057547986 -10 Left 1057547976 9:96032189-96032211 CCCCACACACCTCCCTTCATCAG No data
Right 1057547986 9:96032202-96032224 CCTTCATCAGGGAAAGGCCAGGG No data
1057547976_1057547991 29 Left 1057547976 9:96032189-96032211 CCCCACACACCTCCCTTCATCAG No data
Right 1057547991 9:96032241-96032263 GCCACTCCCATGCCTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057547976 Original CRISPR CTGATGAAGGGAGGTGTGTG GGG (reversed) Intergenic
No off target data available for this crispr