ID: 1057551175

View in Genome Browser
Species Human (GRCh38)
Location 9:96051771-96051793
Sequence CCTTATAAGAAGAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057551160_1057551175 26 Left 1057551160 9:96051722-96051744 CCCCAAGTCCTCACTTGACCTGG No data
Right 1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG No data
1057551164_1057551175 24 Left 1057551164 9:96051724-96051746 CCAAGTCCTCACTTGACCTGGGA No data
Right 1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG No data
1057551165_1057551175 18 Left 1057551165 9:96051730-96051752 CCTCACTTGACCTGGGAAGTCCA No data
Right 1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG No data
1057551168_1057551175 -2 Left 1057551168 9:96051750-96051772 CCAGCTGGCCTCACCTCTCACCC No data
Right 1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG No data
1057551162_1057551175 25 Left 1057551162 9:96051723-96051745 CCCAAGTCCTCACTTGACCTGGG No data
Right 1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG No data
1057551167_1057551175 8 Left 1057551167 9:96051740-96051762 CCTGGGAAGTCCAGCTGGCCTCA 0: 2
1: 43
2: 422
3: 310
4: 352
Right 1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG No data
1057551169_1057551175 -10 Left 1057551169 9:96051758-96051780 CCTCACCTCTCACCCTTATAAGA No data
Right 1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057551175 Original CRISPR CCTTATAAGAAGAGAGAGGA GGG Intergenic
No off target data available for this crispr