ID: 1057552757

View in Genome Browser
Species Human (GRCh38)
Location 9:96064083-96064105
Sequence GCTTCGGGTGAAACAGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057552757_1057552760 -8 Left 1057552757 9:96064083-96064105 CCTGGATCTGTTTCACCCGAAGC No data
Right 1057552760 9:96064098-96064120 CCCGAAGCAAGAGCACTAGTGGG No data
1057552757_1057552758 -9 Left 1057552757 9:96064083-96064105 CCTGGATCTGTTTCACCCGAAGC No data
Right 1057552758 9:96064097-96064119 ACCCGAAGCAAGAGCACTAGTGG No data
1057552757_1057552765 27 Left 1057552757 9:96064083-96064105 CCTGGATCTGTTTCACCCGAAGC No data
Right 1057552765 9:96064133-96064155 AATGCAGAGCCGTGTGGCTCTGG No data
1057552757_1057552766 28 Left 1057552757 9:96064083-96064105 CCTGGATCTGTTTCACCCGAAGC No data
Right 1057552766 9:96064134-96064156 ATGCAGAGCCGTGTGGCTCTGGG No data
1057552757_1057552764 21 Left 1057552757 9:96064083-96064105 CCTGGATCTGTTTCACCCGAAGC No data
Right 1057552764 9:96064127-96064149 AGAGTGAATGCAGAGCCGTGTGG No data
1057552757_1057552762 -3 Left 1057552757 9:96064083-96064105 CCTGGATCTGTTTCACCCGAAGC No data
Right 1057552762 9:96064103-96064125 AGCAAGAGCACTAGTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057552757 Original CRISPR GCTTCGGGTGAAACAGATCC AGG (reversed) Intergenic
No off target data available for this crispr