ID: 1057553150

View in Genome Browser
Species Human (GRCh38)
Location 9:96066836-96066858
Sequence TGTCCCCAAAGGGGGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057553150_1057553164 -7 Left 1057553150 9:96066836-96066858 CCCCCATGCCCCCTTTGGGGACA No data
Right 1057553164 9:96066852-96066874 GGGGACAGCTGAGGGGGGCTGGG No data
1057553150_1057553165 5 Left 1057553150 9:96066836-96066858 CCCCCATGCCCCCTTTGGGGACA No data
Right 1057553165 9:96066864-96066886 GGGGGGCTGGGTGTCCCTTTAGG No data
1057553150_1057553163 -8 Left 1057553150 9:96066836-96066858 CCCCCATGCCCCCTTTGGGGACA No data
Right 1057553163 9:96066851-96066873 TGGGGACAGCTGAGGGGGGCTGG No data
1057553150_1057553168 26 Left 1057553150 9:96066836-96066858 CCCCCATGCCCCCTTTGGGGACA No data
Right 1057553168 9:96066885-96066907 GGAAAATATTTGAACACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057553150 Original CRISPR TGTCCCCAAAGGGGGCATGG GGG (reversed) Intergenic