ID: 1057555069

View in Genome Browser
Species Human (GRCh38)
Location 9:96081575-96081597
Sequence GAGAGGAAGGATAAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057555069_1057555081 20 Left 1057555069 9:96081575-96081597 CCTGCCCCCTTATCCTTCCTCTC No data
Right 1057555081 9:96081618-96081640 TATGCAAGAGTTATTTGTTCCGG No data
1057555069_1057555076 -8 Left 1057555069 9:96081575-96081597 CCTGCCCCCTTATCCTTCCTCTC No data
Right 1057555076 9:96081590-96081612 TTCCTCTCTGGCTCCCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057555069 Original CRISPR GAGAGGAAGGATAAGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr