ID: 1057556925

View in Genome Browser
Species Human (GRCh38)
Location 9:96095436-96095458
Sequence CCCTGCCATCAGCAAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057556916_1057556925 19 Left 1057556916 9:96095394-96095416 CCAGCTCCTCCAGGGAAGTGTTC No data
Right 1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG No data
1057556919_1057556925 10 Left 1057556919 9:96095403-96095425 CCAGGGAAGTGTTCATGGCCAGA No data
Right 1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG No data
1057556915_1057556925 20 Left 1057556915 9:96095393-96095415 CCCAGCTCCTCCAGGGAAGTGTT No data
Right 1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG No data
1057556920_1057556925 -8 Left 1057556920 9:96095421-96095443 CCAGAGTCCCATGTTCCCTGCCA No data
Right 1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG No data
1057556918_1057556925 13 Left 1057556918 9:96095400-96095422 CCTCCAGGGAAGTGTTCATGGCC No data
Right 1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057556925 Original CRISPR CCCTGCCATCAGCAAGGCCC TGG Intergenic
No off target data available for this crispr