ID: 1057557905

View in Genome Browser
Species Human (GRCh38)
Location 9:96102276-96102298
Sequence CCCTGGCCTTCTGTCATGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057557905_1057557915 27 Left 1057557905 9:96102276-96102298 CCAATCATGACAGAAGGCCAGGG No data
Right 1057557915 9:96102326-96102348 AGAAGGAGAAGAAGGAGGCCGGG No data
1057557905_1057557911 10 Left 1057557905 9:96102276-96102298 CCAATCATGACAGAAGGCCAGGG No data
Right 1057557911 9:96102309-96102331 AGAAGTGTTAGCAAGACAGAAGG No data
1057557905_1057557914 26 Left 1057557905 9:96102276-96102298 CCAATCATGACAGAAGGCCAGGG No data
Right 1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG No data
1057557905_1057557913 22 Left 1057557905 9:96102276-96102298 CCAATCATGACAGAAGGCCAGGG No data
Right 1057557913 9:96102321-96102343 AAGACAGAAGGAGAAGAAGGAGG No data
1057557905_1057557912 19 Left 1057557905 9:96102276-96102298 CCAATCATGACAGAAGGCCAGGG No data
Right 1057557912 9:96102318-96102340 AGCAAGACAGAAGGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057557905 Original CRISPR CCCTGGCCTTCTGTCATGAT TGG (reversed) Intergenic
No off target data available for this crispr