ID: 1057557910

View in Genome Browser
Species Human (GRCh38)
Location 9:96102293-96102315
Sequence CACTTCTGCCTGCTTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057557910_1057557912 2 Left 1057557910 9:96102293-96102315 CCAGGGGGAAGCAGGCAGAAGTG No data
Right 1057557912 9:96102318-96102340 AGCAAGACAGAAGGAGAAGAAGG No data
1057557910_1057557916 15 Left 1057557910 9:96102293-96102315 CCAGGGGGAAGCAGGCAGAAGTG No data
Right 1057557916 9:96102331-96102353 GAGAAGAAGGAGGCCGGGCATGG No data
1057557910_1057557913 5 Left 1057557910 9:96102293-96102315 CCAGGGGGAAGCAGGCAGAAGTG No data
Right 1057557913 9:96102321-96102343 AAGACAGAAGGAGAAGAAGGAGG No data
1057557910_1057557911 -7 Left 1057557910 9:96102293-96102315 CCAGGGGGAAGCAGGCAGAAGTG No data
Right 1057557911 9:96102309-96102331 AGAAGTGTTAGCAAGACAGAAGG No data
1057557910_1057557914 9 Left 1057557910 9:96102293-96102315 CCAGGGGGAAGCAGGCAGAAGTG No data
Right 1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG No data
1057557910_1057557915 10 Left 1057557910 9:96102293-96102315 CCAGGGGGAAGCAGGCAGAAGTG No data
Right 1057557915 9:96102326-96102348 AGAAGGAGAAGAAGGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057557910 Original CRISPR CACTTCTGCCTGCTTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr