ID: 1057557914

View in Genome Browser
Species Human (GRCh38)
Location 9:96102325-96102347
Sequence CAGAAGGAGAAGAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057557905_1057557914 26 Left 1057557905 9:96102276-96102298 CCAATCATGACAGAAGGCCAGGG No data
Right 1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG No data
1057557910_1057557914 9 Left 1057557910 9:96102293-96102315 CCAGGGGGAAGCAGGCAGAAGTG No data
Right 1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057557914 Original CRISPR CAGAAGGAGAAGAAGGAGGC CGG Intergenic
No off target data available for this crispr