ID: 1057558464

View in Genome Browser
Species Human (GRCh38)
Location 9:96108286-96108308
Sequence CCTTCCAGGGAGGAGTAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057558464_1057558473 -3 Left 1057558464 9:96108286-96108308 CCATCCTACTCCTCCCTGGAAGG 0: 1
1: 0
2: 1
3: 40
4: 336
Right 1057558473 9:96108306-96108328 AGGAGGCCCTCTGTGCTGGGAGG 0: 1
1: 0
2: 3
3: 30
4: 302
1057558464_1057558471 -7 Left 1057558464 9:96108286-96108308 CCATCCTACTCCTCCCTGGAAGG 0: 1
1: 0
2: 1
3: 40
4: 336
Right 1057558471 9:96108302-96108324 TGGAAGGAGGCCCTCTGTGCTGG 0: 1
1: 1
2: 0
3: 28
4: 256
1057558464_1057558472 -6 Left 1057558464 9:96108286-96108308 CCATCCTACTCCTCCCTGGAAGG 0: 1
1: 0
2: 1
3: 40
4: 336
Right 1057558472 9:96108303-96108325 GGAAGGAGGCCCTCTGTGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 300
1057558464_1057558474 2 Left 1057558464 9:96108286-96108308 CCATCCTACTCCTCCCTGGAAGG 0: 1
1: 0
2: 1
3: 40
4: 336
Right 1057558474 9:96108311-96108333 GCCCTCTGTGCTGGGAGGAGAGG 0: 1
1: 0
2: 5
3: 51
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057558464 Original CRISPR CCTTCCAGGGAGGAGTAGGA TGG (reversed) Exonic
900356349 1:2266627-2266649 CTTTCCAGGGAGGAGGGTGATGG + Intronic
901077928 1:6567014-6567036 ACTGGCAGAGAGGAGTAGGAGGG + Intronic
901606429 1:10462781-10462803 CCTGACAGGGAGGAATAGCAGGG - Intronic
901664737 1:10819806-10819828 CCTTCCAGGGGGCACTGGGAGGG + Intergenic
902673649 1:17993374-17993396 CCTTCCAGGGAGGAGGCAGGAGG + Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
903935664 1:26893176-26893198 CCTTTCTTGGAGGAGGAGGAGGG - Intronic
904470591 1:30733714-30733736 CCTGCCAGGGAGGGGCGGGAGGG + Exonic
904659789 1:32075805-32075827 CCTACCAGGGAGGTGTGGGAGGG - Exonic
904896723 1:33823259-33823281 CCTTCCAGGGAGGACTGAGCAGG + Intronic
904948117 1:34214202-34214224 CATTCCAGGCAGGAGGAGCAAGG + Intronic
906661297 1:47584338-47584360 CCCTTCAAGGAGGAGTAGGCAGG + Intergenic
906693834 1:47810929-47810951 CCTGCCAGGGAGGACAAGGCGGG + Intronic
906901816 1:49843920-49843942 CCTGCCAGGAAGCAGGAGGAAGG + Intronic
912272363 1:108224166-108224188 TCTTCTAGGGAGGAGCGGGAGGG + Intronic
912295858 1:108470155-108470177 TCTTCTAGGGAGGAGCGGGAGGG - Intronic
913645398 1:120849856-120849878 CATTCCAGGGAGAATTAGCAGGG + Intergenic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
914412031 1:147438602-147438624 GCTACCAGGGAGGAGGGGGAAGG - Intergenic
914510852 1:148330595-148330617 CCCAGCAGGGAGGAGCAGGAAGG - Intergenic
914530966 1:148523707-148523729 CATTCCAGGGAGAATTAGCAGGG - Intergenic
915031470 1:152883498-152883520 ACTTCCTGGGAGGAGGAAGATGG + Intronic
915194371 1:154178429-154178451 CCCTCCAGGGTGGAGTGGTAGGG + Intronic
916187775 1:162149328-162149350 CCTTCCAGTCAAGAGTGGGAGGG + Intronic
917510206 1:175663310-175663332 CATTCCCAGGAGGAGTATGAGGG + Intronic
918798534 1:188939093-188939115 CATTCCAGTGAGGAGGAGGAGGG + Intergenic
920435868 1:205946734-205946756 ACTCCCAGGAAGAAGTAGGATGG + Intergenic
920732673 1:208502586-208502608 CCCTCCAGGGAAGAGTAATATGG + Intergenic
921217838 1:212951826-212951848 GCTTCCAGGGCGGAGTTGGGGGG + Intronic
921294664 1:213690545-213690567 TCCTAGAGGGAGGAGTAGGATGG + Intergenic
922824814 1:228510425-228510447 CCTTTCAGGGAGGAGGGGGCTGG + Intergenic
922996577 1:229967573-229967595 CCATTCAGAGAGGAGTAGGAAGG + Intergenic
923536736 1:234858251-234858273 GGGTCCAGGGAGGAGGAGGATGG - Intergenic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
1063364328 10:5480662-5480684 CCCTCCAGGGAGGGGAAGGCAGG - Intergenic
1063956429 10:11271853-11271875 CCTTCCAAGGTGGAATAGGGAGG - Intronic
1064037556 10:11926826-11926848 TCTTCCAAGGAGGAATTGGAGGG + Intronic
1064084362 10:12334103-12334125 TCTGCCAGGGAGCTGTAGGAAGG + Intergenic
1064532379 10:16323386-16323408 CCTCCCAGGGAAGACTAGCAAGG + Intergenic
1066634754 10:37489549-37489571 TCTGCCAGGGAGCTGTAGGAAGG + Intergenic
1067350576 10:45472150-45472172 TGTTCCTGGGAGGAGGAGGAGGG - Intronic
1068783444 10:60944766-60944788 CCGCCCAGGGAGGAGGAGGCTGG - Intronic
1069124975 10:64619079-64619101 CCTGCCAGGGAGGTGTCAGATGG + Intergenic
1070523767 10:77277164-77277186 CCTTCAAGGGAGGAGAAGAAGGG + Intronic
1070667826 10:78358039-78358061 CCTTCCAGAGAGGAGAACAATGG - Intergenic
1071358237 10:84819102-84819124 CCATCCAGGGAGGAGGACGTTGG - Intergenic
1071800893 10:89058767-89058789 CCTTTCAGGTAGGAGTGAGAAGG - Intergenic
1072010050 10:91294808-91294830 CCTTTCAGGAAGGACTTGGAGGG + Intergenic
1072226336 10:93373336-93373358 CCTCCCAGAGAAGAGTAGGAGGG - Intronic
1072518251 10:96208025-96208047 CCTTGCAGGGTGGAGAGGGATGG + Intronic
1073093179 10:100961961-100961983 CCTTTCATAGAGGAGTAGAAAGG + Intronic
1073185050 10:101610899-101610921 CCTTCCAGGAAGGGGCAGAAAGG + Exonic
1073209089 10:101783748-101783770 CTTTGCTGGGAGGAGTAAGAAGG - Intergenic
1073431642 10:103491140-103491162 CCTGCCAGGGAGGAGTTGCTGGG + Intergenic
1074447581 10:113533241-113533263 GCTTCCAGGGAGCAGCTGGAAGG + Intergenic
1074813956 10:117131039-117131061 CCCTCCAGGGGTGAGAAGGAAGG - Intronic
1075542759 10:123329310-123329332 CTTTCCAATGAGGAGAAGGAAGG - Intergenic
1075680619 10:124328647-124328669 CCTCTCAGGGAGCAGTGGGATGG + Intergenic
1076021569 10:127077889-127077911 CATTCCATGGAGGGGCAGGAGGG + Intronic
1076727611 10:132420816-132420838 CCGTCCAGGCAGGATTTGGAAGG - Intergenic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1077626200 11:3774074-3774096 CATTACAGGGCGGAGTAGAAAGG - Intronic
1078072566 11:8126658-8126680 CCTTACATGGAGGACTGGGAAGG - Exonic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1078721759 11:13891004-13891026 CCTTCCAGGGTGGAGCAGCGTGG + Intergenic
1079937567 11:26636707-26636729 CTTTCCAGCCACGAGTAGGATGG + Intronic
1080718181 11:34824164-34824186 CCTGCTAGGGAGGAGTATGTTGG - Intergenic
1080800804 11:35608672-35608694 CCTGCTAGGGAGGGGTAGTAAGG - Intergenic
1081318476 11:41660754-41660776 CCATCTAGAGAGGAGTGGGAGGG + Intergenic
1081655001 11:44851273-44851295 ACATCCAGGGAGCTGTAGGAAGG - Intronic
1081752150 11:45518828-45518850 CCTAGCAGGGAGGGGCAGGAAGG - Intergenic
1084566357 11:69931115-69931137 ACACCCAGGGAGGAGGAGGAGGG - Intergenic
1085205110 11:74726990-74727012 CCTGCCAGGGAGGAGTGGACAGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1087584583 11:100102254-100102276 CTTTTCTGGCAGGAGTAGGATGG + Intronic
1089076358 11:115741840-115741862 CTTCCCAGAGAGGAGTAGGTGGG + Intergenic
1089292296 11:117444545-117444567 CCGTCCAGGGAGGAGGGGGCGGG + Intronic
1089784134 11:120895889-120895911 CCATGCAGAGAGGAGGAGGAAGG + Intronic
1091788692 12:3258610-3258632 CCTTGGTGGGAGGAGGAGGAGGG - Intronic
1091917018 12:4277011-4277033 CCTACCAGTGAGGAGGGGGAGGG - Intronic
1092386904 12:8042751-8042773 CATTGAAAGGAGGAGTAGGAAGG + Intronic
1092536937 12:9397926-9397948 CCTTCCAGGGAACAGTTGTATGG + Intergenic
1092572467 12:9739958-9739980 GCTTGCAGGGAGGTGTGGGAGGG - Intergenic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093172841 12:15878497-15878519 ACTTGGAGGGAGGAGTGGGAGGG + Intronic
1093582054 12:20794226-20794248 CCTTCCAGAGAGCCCTAGGAAGG - Intergenic
1093645165 12:21577763-21577785 TATTCCTGGGATGAGTAGGAAGG + Intronic
1094181497 12:27596967-27596989 TCTTCCAGGGAGGAGGTGGGTGG - Intronic
1094513553 12:31112528-31112550 CCTTCCAGGGAACAGTTGTATGG + Intergenic
1095975460 12:47938112-47938134 CCTTCCTGGAGGGAGAAGGAGGG + Intronic
1096567297 12:52492562-52492584 CCTGCCAGGGAGACCTAGGAGGG - Intronic
1097083079 12:56447630-56447652 GCTTACAGAGATGAGTAGGATGG - Intronic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1098241555 12:68472541-68472563 CCTTCCATGTGGTAGTAGGATGG - Intergenic
1098481762 12:70969890-70969912 CCTGTCAGGGAGGAGTGGGAGGG + Intergenic
1099050290 12:77774304-77774326 GCTTCCATGAAGCAGTAGGATGG + Intergenic
1099978180 12:89568480-89568502 CCTGCCAGGGAGGAGGCTGAGGG - Intergenic
1100334911 12:93619791-93619813 CATTCCAGGCAGGAATGGGAGGG - Intergenic
1101575491 12:105993342-105993364 CCTTCCTGGCGGGAGTAGGGTGG + Intergenic
1103080483 12:118020084-118020106 CCTTCCAGGCAGGAATATGGTGG - Intronic
1103890977 12:124238937-124238959 CCTTCCTGGGATGAGTGGGTAGG + Intronic
1104088101 12:125493907-125493929 ATTTCCAGGGAGGAGGAGGAGGG - Intronic
1104190747 12:126479942-126479964 GCTTCCAGGGAGGGGCAGGGAGG - Intergenic
1104674920 12:130705840-130705862 CCTTGCAGGGATGGGTAGGCTGG - Intronic
1104735487 12:131133587-131133609 CCTTCCGGGGAGGTGCAGGCAGG + Intronic
1106243544 13:27928279-27928301 CCTTCCAGGGAGGCCCAGGGAGG + Intergenic
1107140431 13:36992916-36992938 CCTCCCAGGGAGGACAAGCAAGG - Intronic
1111210819 13:85076928-85076950 TCTTCCTGGGATGAGTAGAATGG - Intergenic
1113416918 13:110136078-110136100 CCCAGCCGGGAGGAGTAGGATGG - Intergenic
1113641684 13:111962257-111962279 CCTTGCAGGGATGAGAATGACGG - Intergenic
1115203419 14:30876002-30876024 CATTCCATGGAAGAGAAGGAAGG - Intronic
1115334687 14:32233099-32233121 CTTTTCAGGGAGATGTAGGAAGG + Intergenic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119474658 14:74920141-74920163 CCAGCCAGGAAGGAGGAGGAAGG + Intronic
1119893714 14:78202161-78202183 CCATCCTGGGTGAAGTAGGAGGG + Intergenic
1120759383 14:88272129-88272151 CTTTCCAGGGAGGAGGAAGGAGG - Intronic
1121144672 14:91573854-91573876 ACTTGCAGGGAGGAGGAGGCTGG + Intergenic
1121781586 14:96625499-96625521 CCTCCCAGCGAGGAGGAGAAGGG - Intergenic
1122254079 14:100463986-100464008 CCATGCAGGGAGGAGAATGAAGG - Intronic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1122981184 14:105193008-105193030 CCTTCCTGGGAAGAGGAGGGAGG + Intergenic
1123936642 15:25197200-25197222 CCTTCCAGGGTTGAGTGGCAGGG + Intergenic
1124055506 15:26237898-26237920 CCTTCCAGAGAGGACTTGGAAGG - Intergenic
1124609425 15:31198161-31198183 TCTACGAGGGAGGAGGAGGAGGG - Intergenic
1124905042 15:33860329-33860351 CCAACCAGGGAGAAGTAGAAAGG + Intronic
1125098717 15:35885288-35885310 CTTACCTGGGAGGAGTGGGAGGG - Intergenic
1128248643 15:66149952-66149974 GCTTCCAGGGAGCAATGGGATGG - Intronic
1129707934 15:77805288-77805310 TCTTCCCAGCAGGAGTAGGAGGG - Intronic
1129893137 15:79085066-79085088 CATTCCAGTGGGGAGAAGGATGG + Intronic
1131163951 15:90128824-90128846 CCTTCCAAGAAGGAGAAAGACGG + Intergenic
1131508646 15:93036746-93036768 CCCTCAAGCGAGGAGTAGGTGGG + Intronic
1131572609 15:93554231-93554253 CCTTCCAGTGAAGACTTGGATGG + Intergenic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1135354384 16:21757320-21757342 CCTGACAGGGAGGACAAGGAAGG - Intronic
1135398809 16:22151454-22151476 GATCCCAGGGAAGAGTAGGAGGG - Intronic
1135452875 16:22573460-22573482 CCTGACAGGGAGGACAAGGAAGG - Intergenic
1136636514 16:31527791-31527813 CATTCTAGGGAGGAGAAGAAGGG - Intergenic
1138645439 16:58421108-58421130 CATTCCAGGCTGGAGAAGGATGG + Intergenic
1139603338 16:68000178-68000200 GCTACCAGGAAGGAGTAGGTGGG + Intronic
1141178985 16:81739549-81739571 CCTTCCCTGGAGGAGTACGGGGG - Intronic
1141752059 16:85965092-85965114 CCTTCCAGTGAGTGGTAGGGTGG + Intergenic
1142308141 16:89297043-89297065 CCTCCCAGGGAGGTAGAGGAAGG - Intronic
1142591583 17:1008528-1008550 CCTTGTGGGGAGGAGTGGGAAGG - Intronic
1142986923 17:3700997-3701019 CCTGTGAGGGAGGAGAAGGAGGG - Intergenic
1143443802 17:6995803-6995825 CCTTCCCGGGAGGTCCAGGAAGG + Intronic
1143691973 17:8575823-8575845 ACTACCTGGGAGGAGAAGGAGGG - Intronic
1144577242 17:16436818-16436840 CCTCCCAAGGAGGATGAGGATGG + Exonic
1144769361 17:17750992-17751014 CCTTCCACAGAGGAGGAAGATGG + Intronic
1145158675 17:20559654-20559676 CTTTCCAGGGCGGTGCAGGAAGG - Intergenic
1146673596 17:34758222-34758244 CCTCCCAGGGATGAGGAGGAAGG - Intergenic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1147165625 17:38591699-38591721 CCTTCCAGGCAGGAGGAGTCAGG - Intronic
1149296430 17:55265767-55265789 CCTTTCATGGAGGAGGAGGAAGG - Intronic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1150124492 17:62627646-62627668 CCTCCCGGGGAGGAGGAGGGAGG - Exonic
1150748069 17:67832726-67832748 GCTGCCAGGGATGAGCAGGAGGG - Intronic
1150973788 17:70060799-70060821 CCTCCCAGGGTGGAATTGGATGG - Intronic
1151396160 17:73824403-73824425 CCTCCCAAGAAGCAGTAGGACGG - Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151888075 17:76934964-76934986 CCTTCCAGGGAGCAGGAGCTGGG + Intronic
1151896391 17:76983419-76983441 CCTTCCAGGCTGGAGGAGAAGGG - Intergenic
1152418083 17:80175877-80175899 CCTGCCAGGAAGCAGGAGGAGGG - Intronic
1152820550 17:82435667-82435689 CCTGCAAGGAAGGAGCAGGACGG - Exonic
1152935020 17:83131630-83131652 CCTTCCAGGGATAAGTATCAAGG - Intergenic
1153320681 18:3771372-3771394 CCTTCCACGGGGGCGCAGGAAGG - Intronic
1154219051 18:12436105-12436127 TGTTGCAGGGAGGAGTGGGAAGG - Intergenic
1154219337 18:12438396-12438418 TGTTGCAGGGAGGAGTGGGAAGG + Intergenic
1155216432 18:23647557-23647579 CCTCCCAGGCTGGAGTGGGATGG + Intronic
1156036593 18:32772046-32772068 CCTTCCAGGGCTGAGCAGAAAGG + Exonic
1156465922 18:37347798-37347820 CCCTGCAGGGAGGAAGAGGACGG + Intronic
1157584638 18:48793241-48793263 CCTGCCAGGGAGAAGCAGGGAGG + Intronic
1160231310 18:77051703-77051725 CCTTCCAGGGAGAAGAAGAAAGG + Intronic
1161342384 19:3750362-3750384 ACTTCCTGGGAGGCCTAGGAAGG + Intronic
1162637477 19:11981323-11981345 CCTTCAAGGGAGGATAAGGCAGG - Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1166044649 19:40222888-40222910 CCTTCCAGGGCTGAGAACGAAGG - Exonic
1167300196 19:48673447-48673469 GGTTCCAGAGAGGAGGAGGAGGG - Intergenic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
925004491 2:430521-430543 CCCTGCAGGCAGGAGTGGGAGGG + Intergenic
925200972 2:1967702-1967724 CGTTCCAGGGTGGAAGAGGATGG + Intronic
925429532 2:3779191-3779213 ACGTCCAGGGAGGTGAAGGAAGG + Intronic
925686941 2:6482486-6482508 CCATCCAGGGAGAAGGAGGTTGG - Intergenic
926046220 2:9711578-9711600 CCTTCAAGGTATGAGCAGGATGG - Intergenic
926561915 2:14427035-14427057 CCCTCCAGGTTGGAATAGGAAGG + Intergenic
926590474 2:14735047-14735069 CATTCCAGGCAGGAGGAAGAGGG - Intergenic
927638512 2:24832525-24832547 CCTTCCAGGGAGGGGTTAAACGG - Intronic
927863122 2:26572795-26572817 GCTTCCGAGGAGGAGAAGGAGGG + Intronic
929201443 2:39241636-39241658 CATTCCAGGCAGGGGTATGAAGG - Intergenic
929531192 2:42754008-42754030 TGTTCCTTGGAGGAGTAGGAGGG - Exonic
929756228 2:44767996-44768018 TCTTTCAGGGAGGAGACGGAGGG - Intronic
931691242 2:64836588-64836610 CTGTCCTGGGAGGAGTGGGAGGG + Intergenic
932305945 2:70704437-70704459 TCTTTCAGGGAGGAGCTGGAAGG - Exonic
932594553 2:73086065-73086087 CCTTGCAGGGAGGGGAAGGCTGG - Intronic
933862617 2:86485022-86485044 CCTTCCAGGTATGATTATGAAGG + Exonic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934960727 2:98670179-98670201 CCTTTTAGGCAGGAGTAAGATGG + Intronic
935863212 2:107356928-107356950 CCTTCCCTGGAGCAGGAGGAAGG - Intergenic
936078563 2:109417279-109417301 CCATCCATGGAGGTGTAGGTGGG - Intronic
936515918 2:113181587-113181609 CCTTCTAGGGAGGAAGAGGCTGG - Intronic
937450551 2:121998858-121998880 CATGCCAGGGAGGTGTAGGCTGG + Intergenic
938951597 2:136259788-136259810 CCTTCAAGGAAGGAGAAGAAGGG - Intergenic
939698499 2:145358746-145358768 TCTAACAGGGAGAAGTAGGAGGG + Intergenic
940854836 2:158722076-158722098 CCTTACAGGAAGGAGTCAGAGGG - Intergenic
944711027 2:202335512-202335534 CCTACCAGGGACTCGTAGGAAGG - Intergenic
944861121 2:203816833-203816855 CCCCCAAGGGTGGAGTAGGATGG + Intergenic
946396787 2:219447479-219447501 GCTTCCAGGGACCACTAGGAAGG + Intronic
947515593 2:230801267-230801289 TCTTTCAGGGAGGAGTAGGAAGG - Intronic
948226831 2:236317969-236317991 TCTGCCTGGGAGGAGCAGGATGG - Intergenic
948227652 2:236323996-236324018 CCTTCCAGTGAGGACTAGGCGGG + Intergenic
948868855 2:240788365-240788387 CCCACAAGGCAGGAGTAGGATGG - Intronic
1170535978 20:17341198-17341220 CCTTCCAGGCTGGAGTACGGTGG - Intronic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172475277 20:35232592-35232614 CCTTTGAGGGAGGAGAATGATGG + Intronic
1172827304 20:37800417-37800439 CCTTCCAGAGAGCAGTGGTAGGG - Intronic
1173573654 20:44095921-44095943 CCTTTCAGGAAGCTGTAGGAGGG + Intergenic
1174054986 20:47792435-47792457 CCTACCAGAGTGGAGTGGGAGGG - Intergenic
1175954052 20:62599331-62599353 CCACCCCGGGAGGAGAAGGAGGG - Intergenic
1176065418 20:63191758-63191780 CCTTCCAGGGAGGAGCCTGGTGG + Intergenic
1176170201 20:63693306-63693328 CCTTCCACGCAGGAGTCTGAGGG - Intronic
1176549271 21:8214454-8214476 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176557164 21:8258677-8258699 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176568203 21:8397492-8397514 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176576106 21:8441712-8441734 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1177894974 21:26846431-26846453 CCTTCCTGGTAGGAAGAGGAAGG - Intergenic
1178111173 21:29371686-29371708 CCTTGTAGGAAGGTGTAGGAGGG - Intronic
1178978252 21:37239132-37239154 GCCTCCAAGGAGGAGCAGGAGGG + Intronic
1179546304 21:42114526-42114548 CCCTTGAGGGAGGTGTAGGATGG + Intronic
1179555764 21:42174626-42174648 TGTTCCAGGGAGGATTAGGAGGG - Intergenic
1180824652 22:18854163-18854185 CCTTCCAAGGAGGACTAACACGG + Intronic
1180939859 22:19653027-19653049 ACATCCAAGGAGGAGAAGGAAGG + Intergenic
1181188080 22:21120384-21120406 CCTTCCAAGGAGGACTAACACGG - Intergenic
1181211118 22:21290109-21290131 CCTTCCAAGGAGGACTAACACGG + Intergenic
1181501123 22:23316137-23316159 CCTTCCAAGGAGGACTAACATGG - Exonic
1181651032 22:24259281-24259303 CCTTCCAAGGAGGACTAACACGG + Intergenic
1181706350 22:24651458-24651480 CCTTCCAAGGAGGACTAACACGG - Intergenic
1182020978 22:27081200-27081222 CTTTGCAGGGAGGAGTAGCAGGG - Intergenic
1183304337 22:37074306-37074328 CCTTCCAGGAAGGAACAGAATGG - Intronic
1184132118 22:42523088-42523110 GCTTGCTGGGAGGAGGAGGAGGG + Intergenic
1184342555 22:43893902-43893924 CCAGGCAGGGAGGAGTAGGGAGG + Intergenic
1184514451 22:44953360-44953382 ACTTGCAGGGAGGGGTAGGGAGG - Intronic
1184719527 22:46302484-46302506 GCTACCAGGGAGGCTTAGGAAGG - Intronic
1185083588 22:48723612-48723634 TCTTCCAGGCAGGGGGAGGATGG - Intronic
1185221400 22:49630766-49630788 CCCTCCAGCAAGGAGTAGGCGGG + Intronic
1185344560 22:50305681-50305703 CGTGCCAGGGAGGAGCAGGCAGG - Intronic
1203215827 22_KI270731v1_random:5322-5344 CCTTCCAAGGAGGACTAACACGG - Intergenic
1203254156 22_KI270733v1_random:130770-130792 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1203262212 22_KI270733v1_random:175849-175871 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1203274798 22_KI270734v1_random:80069-80091 CCTTCCAAGGAGGACTAACACGG + Intergenic
949612628 3:5718431-5718453 ACTTCCAGTGAGCAGAAGGAAGG + Intergenic
949871199 3:8590682-8590704 CCTTCCAGGGTTCAGTGGGAAGG + Intergenic
950430268 3:12946898-12946920 TCTGCCAGGGAGGAGTGGGTAGG - Intronic
953493396 3:43367624-43367646 ACTTCCAGGGAGGTGTCAGAAGG + Intronic
953981012 3:47412988-47413010 AATTCCAGGGAGGAGGAGGGGGG - Exonic
954527419 3:51284337-51284359 CCTTCCAGGGAGAAACAGGGAGG - Intronic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
959944355 3:112111553-112111575 CCTGCCATGGGGGATTAGGATGG + Intronic
960245157 3:115392356-115392378 CCTTCCAGGCAGAAGTGTGATGG - Intergenic
963262867 3:143210524-143210546 CCTTCCAGGAAGAACAAGGATGG + Intergenic
963301961 3:143608399-143608421 CATTCCAGGGAGGACAAAGAGGG - Intronic
964391664 3:156204271-156204293 CCATGCAGCGATGAGTAGGAGGG - Intronic
964559410 3:157977122-157977144 CCTGCCAGGCAGGAGTATGGAGG - Intergenic
966767849 3:183478798-183478820 CCCTGCAGGGAAGCGTAGGAAGG - Intergenic
968471782 4:785930-785952 CCTTCCAGAGAGGAGAGGAAAGG + Exonic
968904624 4:3445623-3445645 CCTTTCAGGGAGGTGCAGGGAGG + Intronic
969464205 4:7345017-7345039 CCTTCCAGCCAGCAGCAGGAGGG - Intronic
969467436 4:7366140-7366162 CCTGCCAAGGAGGAGGAGGGTGG - Intronic
971151821 4:24041279-24041301 CCCAGCAGGGAGGAGTTGGAGGG - Intergenic
972250411 4:37294059-37294081 CTTTCCAGAAAGGAGTAGGGGGG - Intronic
976898132 4:90137482-90137504 CTATCCAGTGAGGAGAAGGAAGG + Intronic
981096792 4:140790309-140790331 TCTTTCAGTGAGGAGAAGGAGGG + Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
983105116 4:163677096-163677118 CCTTTCAGGGAGAAATAGGTAGG + Intronic
983426449 4:167589568-167589590 CCTTACTGGGAGGAGGAGGGAGG - Intergenic
983546529 4:168970635-168970657 CCTTGCAGGGAAGGGTGGGAGGG - Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984619575 4:181937175-181937197 CCATCCAGAGAAGAGAAGGAAGG + Intergenic
984622316 4:181967649-181967671 TCTTCCCAGGAGGAGTAAGAGGG + Intergenic
985245100 4:187972263-187972285 GCTTCCAAGGAGGTGTAGCAGGG + Intergenic
986192522 5:5510248-5510270 CCTGCCAGGGTGGAGGGGGAAGG - Intergenic
987910516 5:24138110-24138132 CCTTCAAAGGAGGATTAGAAAGG - Intronic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
989708015 5:44361383-44361405 GCCTCTAGGGAGGAGAAGGATGG - Intronic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
992158892 5:73981487-73981509 CCTTCCAGGAAAGATTAAGAAGG - Intergenic
993308186 5:86295826-86295848 TCTTCTAGGGAGGAGTGGGAGGG - Intergenic
994645520 5:102464032-102464054 ACTTGCAGGGAAGGGTAGGATGG + Intronic
997981830 5:138472444-138472466 CCTTTCAGGTAGGAGGAGGAAGG - Intergenic
998618813 5:143771846-143771868 CCACTCAGGGAGGAGGAGGAAGG + Intergenic
998630398 5:143891781-143891803 CCCTCCAGGTAGGATGAGGAAGG + Intergenic
1000535165 5:162470328-162470350 TCTTCCAGGGAGGAGATGGTAGG - Intergenic
1000879998 5:166686308-166686330 ACTTGGGGGGAGGAGTAGGAGGG - Intergenic
1002540775 5:179905002-179905024 GCTTCCAGGAAGAAGTAGAAGGG - Intronic
1002877633 6:1225728-1225750 CCATCCAGCCAGGTGTAGGATGG + Intergenic
1003479061 6:6514482-6514504 CCTTCCAGTGAGAAGTGGAAGGG - Intergenic
1003542653 6:7031998-7032020 CCTTCCTGGGAGGAAGAGGATGG + Intergenic
1004848011 6:19667227-19667249 CATTCAAGGGAGGAGTAAGAAGG - Intergenic
1006336904 6:33425712-33425734 CCTTCCTGGGAGGAGGCGGAGGG + Intronic
1007636603 6:43303543-43303565 CCTTCCAGGGGTGAATGGGATGG - Intronic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1013041463 6:106438126-106438148 TCTTCCAGGGAGGTGTAGAATGG - Intergenic
1013174941 6:107668956-107668978 GCTTCCAGGGAGCAGAAGGAGGG + Intergenic
1013425394 6:110008008-110008030 CCATCCAAGGAGGATGAGGATGG - Intergenic
1014875821 6:126657647-126657669 CTTCTAAGGGAGGAGTAGGATGG + Intergenic
1015960317 6:138641803-138641825 CTTTTCAGGCAGGAGTAGAAAGG - Intronic
1016019081 6:139216857-139216879 ACTTGCAGGGAAGAGTTGGAGGG + Intergenic
1016100917 6:140099041-140099063 CCTGAATGGGAGGAGTAGGACGG + Intergenic
1016608483 6:145962155-145962177 CTTTCCAGGGAAGATTGGGATGG - Intronic
1018154783 6:160975506-160975528 CCTTTCTGGGAGGAGAAGGAAGG - Intergenic
1018216399 6:161532035-161532057 TGTTTCAGGGAAGAGTAGGATGG - Intronic
1018488185 6:164263668-164263690 CCTTTTTGGGAGGAGAAGGAAGG + Intergenic
1019137887 6:169922526-169922548 GCTGCCTGGGAGGAGGAGGAAGG + Intergenic
1019295501 7:271991-272013 CCCTGCAGGGAGGAGTGGGGAGG + Intergenic
1019295535 7:272122-272144 CCCTGCAGGGAGGAGCAGGGAGG + Intergenic
1019614069 7:1950979-1951001 GCTTCCTGGGAGGAGGAGGCGGG + Intronic
1019614592 7:1953393-1953415 CCCGCCAGGGAGGAGCAGGCAGG + Intronic
1022043328 7:26601805-26601827 CCTTCCAGAAGGGAGAAGGATGG + Intergenic
1023120096 7:36900582-36900604 GCTTCCAGGGCAGAGTTGGAAGG + Intronic
1023167707 7:37359184-37359206 CCTGCAAGGAAGGAGTAGGAAGG - Intronic
1024918710 7:54534306-54534328 CCTCCCAGGGAATAGTGGGAAGG - Intergenic
1025238001 7:57247700-57247722 CCTACCAGAGTGGAGTGGGAGGG + Intergenic
1026901082 7:74037888-74037910 CCTCCCAAGGATGAGTAGGCCGG + Intronic
1030008180 7:105139068-105139090 CCATCCAGGAAGGTGCAGGAAGG - Intronic
1031089532 7:117337685-117337707 CCTCCCAGGGTGGGGTAGGATGG + Intergenic
1031304073 7:120102036-120102058 ACTTCCAGGGAGAAGAAAGACGG - Intergenic
1031760617 7:125708784-125708806 ACTTGCAGGGAAGAGTAGAAGGG - Intergenic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1033230889 7:139596674-139596696 CCTTCCAGGAAGGAGCCGGGAGG - Intronic
1035100500 7:156392333-156392355 CATTCCAGGGAGGAGGAAGCTGG + Intergenic
1035122229 7:156578471-156578493 CCTGCCAGGGAGGAAAAGGAGGG + Intergenic
1035449934 7:158970608-158970630 CCTTACAGGGAGCAGTAAGTGGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037893512 8:22636663-22636685 CCTGCCAAGGAGGAGGAGAAAGG + Intronic
1038128320 8:24699347-24699369 CCTTCGAGGCAGGAGTACAATGG + Intergenic
1038243845 8:25835396-25835418 GCTGCCAGGGAGGAGTTGTAAGG + Intergenic
1038565838 8:28619492-28619514 CAGTCCAGGGAGGAGCAGCAGGG - Intronic
1039131300 8:34267364-34267386 GCTTCCATGGGGGAGTAAGATGG - Intergenic
1039367046 8:36939787-36939809 ACTCCCAGGCAGAAGTAGGAGGG + Intergenic
1039390239 8:37174527-37174549 CTCTCCAGGGAGGACTTGGAGGG - Intergenic
1040822138 8:51573389-51573411 CTTTCCAGTGGGGAGCAGGAAGG - Intronic
1040967924 8:53102521-53102543 TCTTCCAGGCAAGAGAAGGATGG - Intergenic
1041715366 8:60927248-60927270 CCTTCCAGGAATGGGGAGGAGGG - Intergenic
1043524397 8:81080819-81080841 TCTCCCAGGTGGGAGTAGGATGG + Intronic
1043934750 8:86130628-86130650 AGTTCCAGGAAGGAGGAGGAAGG + Intronic
1049208870 8:141376208-141376230 CTTTCCAGTGAGGAATAGGGAGG + Intergenic
1049473052 8:142784735-142784757 CCTTCCAGGGTGGGGACGGACGG + Intergenic
1049910457 9:261144-261166 CCTGGCAGACAGGAGTAGGAGGG + Intronic
1051499275 9:17759238-17759260 CCTTCCAGAGAGGCCCAGGATGG + Intronic
1053382495 9:37660296-37660318 CCTTGCAGGGAGATCTAGGAGGG + Intronic
1056246166 9:84697425-84697447 CCCTCAAGGGAGCAGTGGGAAGG - Intronic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1060201207 9:121652538-121652560 CCTTCCCTGGCTGAGTAGGAGGG + Intronic
1060894631 9:127209722-127209744 CCTTCCTGGGAGGAGGACAAAGG + Intronic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062238820 9:135525244-135525266 CCACCCAGGTAGGAGTGGGATGG - Intronic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1062314170 9:135957612-135957634 TCTTCTGGGGAGGAGCAGGATGG - Intronic
1062578968 9:137221407-137221429 CAGTCCTGGGAGGAGGAGGAAGG + Intronic
1203470557 Un_GL000220v1:113914-113936 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1203478378 Un_GL000220v1:157886-157908 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185550642 X:980720-980742 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185816041 X:3156997-3157019 CCATCCAGTGAAGAGCAGGATGG + Intergenic
1192168829 X:68841983-68842005 CCTTCCAGGTGGCAGTCGGAAGG + Exonic
1192240401 X:69323696-69323718 CCTCCCTGGGAGGTATAGGAGGG - Intergenic
1193036591 X:76957917-76957939 CCATCCAGGGAGGAGTAGTGAGG + Intergenic
1194958467 X:100208381-100208403 CTTTCAAGGGAGGAGGAGGGAGG - Intergenic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1195996532 X:110737265-110737287 CCTTCTTGAGAGGAGAAGGAGGG + Intronic
1197713129 X:129686615-129686637 ACAGCCGGGGAGGAGTAGGAAGG - Intergenic
1198018582 X:132635970-132635992 CCATCCAGGGAGGTCAAGGAAGG - Intronic
1199334279 X:146600307-146600329 CCTTTGAGGGAAGAGTGGGAAGG - Intergenic
1199721440 X:150545546-150545568 CCTTGGAGGGTGGAGTGGGAGGG - Intergenic
1199852505 X:151735849-151735871 GTTTCAAGCGAGGAGTAGGAGGG - Intergenic