ID: 1057560215

View in Genome Browser
Species Human (GRCh38)
Location 9:96122306-96122328
Sequence AGGATCTTCAGGGGTAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057560215_1057560225 18 Left 1057560215 9:96122306-96122328 CCCTCTTTACCCCTGAAGATCCT No data
Right 1057560225 9:96122347-96122369 CAAAGACCTGTGGTGAGCTCAGG No data
1057560215_1057560230 28 Left 1057560215 9:96122306-96122328 CCCTCTTTACCCCTGAAGATCCT No data
Right 1057560230 9:96122357-96122379 TGGTGAGCTCAGGCCTGGGGAGG No data
1057560215_1057560229 25 Left 1057560215 9:96122306-96122328 CCCTCTTTACCCCTGAAGATCCT No data
Right 1057560229 9:96122354-96122376 CTGTGGTGAGCTCAGGCCTGGGG No data
1057560215_1057560228 24 Left 1057560215 9:96122306-96122328 CCCTCTTTACCCCTGAAGATCCT No data
Right 1057560228 9:96122353-96122375 CCTGTGGTGAGCTCAGGCCTGGG No data
1057560215_1057560226 23 Left 1057560215 9:96122306-96122328 CCCTCTTTACCCCTGAAGATCCT No data
Right 1057560226 9:96122352-96122374 ACCTGTGGTGAGCTCAGGCCTGG No data
1057560215_1057560222 -5 Left 1057560215 9:96122306-96122328 CCCTCTTTACCCCTGAAGATCCT No data
Right 1057560222 9:96122324-96122346 ATCCTAGAATCTGGTGGTGCAGG No data
1057560215_1057560224 8 Left 1057560215 9:96122306-96122328 CCCTCTTTACCCCTGAAGATCCT No data
Right 1057560224 9:96122337-96122359 GTGGTGCAGGCAAAGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057560215 Original CRISPR AGGATCTTCAGGGGTAAAGA GGG (reversed) Intergenic
No off target data available for this crispr