ID: 1057563705

View in Genome Browser
Species Human (GRCh38)
Location 9:96149713-96149735
Sequence TGCAGGAAATGCAGCAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057563705_1057563708 0 Left 1057563705 9:96149713-96149735 CCGGGGCTGCTGCATTTCCTGCA No data
Right 1057563708 9:96149736-96149758 ACCCCATCTTCAAGTCCAGGTGG No data
1057563705_1057563712 4 Left 1057563705 9:96149713-96149735 CCGGGGCTGCTGCATTTCCTGCA No data
Right 1057563712 9:96149740-96149762 CATCTTCAAGTCCAGGTGGTAGG No data
1057563705_1057563714 10 Left 1057563705 9:96149713-96149735 CCGGGGCTGCTGCATTTCCTGCA No data
Right 1057563714 9:96149746-96149768 CAAGTCCAGGTGGTAGGGAAAGG No data
1057563705_1057563713 5 Left 1057563705 9:96149713-96149735 CCGGGGCTGCTGCATTTCCTGCA No data
Right 1057563713 9:96149741-96149763 ATCTTCAAGTCCAGGTGGTAGGG No data
1057563705_1057563707 -3 Left 1057563705 9:96149713-96149735 CCGGGGCTGCTGCATTTCCTGCA No data
Right 1057563707 9:96149733-96149755 GCAACCCCATCTTCAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057563705 Original CRISPR TGCAGGAAATGCAGCAGCCC CGG (reversed) Intergenic
No off target data available for this crispr