ID: 1057568548

View in Genome Browser
Species Human (GRCh38)
Location 9:96185881-96185903
Sequence AGAACCACACCCTCTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057568541_1057568548 6 Left 1057568541 9:96185852-96185874 CCCCTGGGGGAAAAAACTGCTCC No data
Right 1057568548 9:96185881-96185903 AGAACCACACCCTCTTTGGGAGG No data
1057568540_1057568548 14 Left 1057568540 9:96185844-96185866 CCAAGTGTCCCCTGGGGGAAAAA No data
Right 1057568548 9:96185881-96185903 AGAACCACACCCTCTTTGGGAGG No data
1057568535_1057568548 24 Left 1057568535 9:96185834-96185856 CCAGATTTTGCCAAGTGTCCCCT No data
Right 1057568548 9:96185881-96185903 AGAACCACACCCTCTTTGGGAGG No data
1057568543_1057568548 4 Left 1057568543 9:96185854-96185876 CCTGGGGGAAAAAACTGCTCCCA No data
Right 1057568548 9:96185881-96185903 AGAACCACACCCTCTTTGGGAGG No data
1057568542_1057568548 5 Left 1057568542 9:96185853-96185875 CCCTGGGGGAAAAAACTGCTCCC No data
Right 1057568548 9:96185881-96185903 AGAACCACACCCTCTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057568548 Original CRISPR AGAACCACACCCTCTTTGGG AGG Intergenic
No off target data available for this crispr