ID: 1057569316

View in Genome Browser
Species Human (GRCh38)
Location 9:96192063-96192085
Sequence ACGGCTGTTGAAACCCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057569316_1057569324 30 Left 1057569316 9:96192063-96192085 CCAGTGTGGGTTTCAACAGCCGT No data
Right 1057569324 9:96192116-96192138 CATGGTTAACCTGATTCCTGTGG No data
1057569316_1057569317 -6 Left 1057569316 9:96192063-96192085 CCAGTGTGGGTTTCAACAGCCGT No data
Right 1057569317 9:96192080-96192102 AGCCGTGCATTTGCCCGTGCTGG No data
1057569316_1057569318 -5 Left 1057569316 9:96192063-96192085 CCAGTGTGGGTTTCAACAGCCGT No data
Right 1057569318 9:96192081-96192103 GCCGTGCATTTGCCCGTGCTGGG No data
1057569316_1057569322 12 Left 1057569316 9:96192063-96192085 CCAGTGTGGGTTTCAACAGCCGT No data
Right 1057569322 9:96192098-96192120 GCTGGGAATCTGCCTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057569316 Original CRISPR ACGGCTGTTGAAACCCACAC TGG (reversed) Intergenic
No off target data available for this crispr