ID: 1057570674

View in Genome Browser
Species Human (GRCh38)
Location 9:96202059-96202081
Sequence CTCAAAAATCTGTACCTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057570674_1057570676 30 Left 1057570674 9:96202059-96202081 CCTTCGAGGTACAGATTTTTGAG No data
Right 1057570676 9:96202112-96202134 GACCTGAGCAAGTGTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057570674 Original CRISPR CTCAAAAATCTGTACCTCGA AGG (reversed) Intergenic
No off target data available for this crispr