ID: 1057577313

View in Genome Browser
Species Human (GRCh38)
Location 9:96253575-96253597
Sequence TGGAGTGACCAGAGAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057577313_1057577320 24 Left 1057577313 9:96253575-96253597 CCATCCACTCTCTGGTCACTCCA 0: 1
1: 0
2: 6
3: 31
4: 367
Right 1057577320 9:96253622-96253644 TGTGTTAACTTGCCTTCTGCGGG No data
1057577313_1057577319 23 Left 1057577313 9:96253575-96253597 CCATCCACTCTCTGGTCACTCCA 0: 1
1: 0
2: 6
3: 31
4: 367
Right 1057577319 9:96253621-96253643 CTGTGTTAACTTGCCTTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057577313 Original CRISPR TGGAGTGACCAGAGAGTGGA TGG (reversed) Intronic
900002191 1:20877-20899 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
900021913 1:191401-191423 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
900831258 1:4967253-4967275 TGGTGTGAGCAGAGAGTGCAGGG - Intergenic
901190013 1:7404173-7404195 TGGAGGGACAAGAGTGTGGGTGG - Intronic
901422767 1:9162215-9162237 TGGTGGGAGCAGAGAGGGGAGGG - Intergenic
902404354 1:16174786-16174808 GGGAAAGACCAGAGAGGGGAGGG - Intergenic
903962688 1:27066738-27066760 TGGAGTGTACAGAGGATGGAGGG + Intergenic
904186856 1:28712249-28712271 TGGCGTGACTACAGAGTGCATGG - Intronic
904218309 1:28942559-28942581 TGGTGTGCCCAGAGAGGGCAAGG - Intronic
904745192 1:32706408-32706430 TGGTGTGCCCAGGGAGGGGATGG - Intergenic
905923714 1:41735551-41735573 GGGAGTGAGCAGAGCCTGGATGG - Intronic
905972150 1:42150405-42150427 TGGAGTAAACAGAGTGTTGATGG + Intergenic
906240402 1:44239051-44239073 GGTAGTGACCAGGGAGTGGGAGG - Intronic
906512473 1:46418390-46418412 TGAAGTGCCCAGAAAGTAGATGG - Intergenic
906658675 1:47567125-47567147 TGGAGCAACCAGAGGGTGGTGGG - Intergenic
910800392 1:91139060-91139082 AGGAGAGTCCAGAGAGTGGTGGG + Intergenic
911180136 1:94853161-94853183 GGGAGTGACCAGTGGGTCGAAGG + Intronic
911730412 1:101286910-101286932 TTGATTGATCAAAGAGTGGAGGG + Intergenic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913174993 1:116265294-116265316 TGGAGGGAACAGAAAGTGGGGGG + Intergenic
917140327 1:171828706-171828728 TGGATTGAAAAGAGAGTGGATGG + Intergenic
917588655 1:176454596-176454618 TGATGTGACCAGAGTATGGAAGG - Intergenic
917649148 1:177059354-177059376 TGTAGTGTCCAGAGAGTGGTAGG - Intronic
919850399 1:201668443-201668465 AGGAGTGATGAGCGAGTGGATGG - Intronic
921451810 1:215317528-215317550 TGGAGTGGGGAGAGAGGGGAGGG - Intergenic
921610901 1:217210969-217210991 GAGAGTGACTAGAGAGTGAATGG - Intergenic
922620834 1:226987066-226987088 TGCACTGAACAGAGATTGGAAGG - Exonic
923419102 1:233795238-233795260 GGGGCTCACCAGAGAGTGGAGGG + Intergenic
1063115212 10:3067778-3067800 TGGGGTGACCGGAGAGAAGAGGG + Intronic
1064005654 10:11696920-11696942 GGGAGTGACCTGTGTGTGGATGG - Intergenic
1064450811 10:15440606-15440628 TGCAGTGACGTGAGGGTGGAGGG + Intergenic
1065972240 10:30814911-30814933 TGGAATGACCAAAGACTAGAAGG + Intergenic
1067173383 10:43925505-43925527 TGCAGTGACCACAGACTGGGCGG + Intergenic
1069751408 10:70747580-70747602 TGGAGACAGCAGAGGGTGGAAGG - Intronic
1070195296 10:74151214-74151236 GGGCGGGACCAGAGAGTGGATGG + Exonic
1070425866 10:76286505-76286527 CTGAGTGACCAGAGAGGGGATGG + Intronic
1070540534 10:77412355-77412377 TGGAGTGGCCAGGGAGAGGGTGG - Intronic
1071499447 10:86193105-86193127 GGGAATGAGGAGAGAGTGGAGGG - Intronic
1072608490 10:97001995-97002017 AGCAGTGCCCAGAGGGTGGAGGG + Intronic
1073457681 10:103647408-103647430 TGGAGAGACCAGGGTGTGGAGGG + Intronic
1073625741 10:105095067-105095089 TGAAGTGACCAGAGATTGATTGG - Intronic
1074726676 10:116317447-116317469 TGGAATGAATAGAAAGTGGAAGG - Intergenic
1075162910 10:120040428-120040450 TGGTGTGCCCAGAGAGTGCATGG + Intergenic
1076288260 10:129322621-129322643 GGGAGTGAAAAGAGAGGGGAGGG - Intergenic
1076578058 10:131483979-131484001 TGGAGTGATGAGTTAGTGGATGG + Intergenic
1076631940 10:131856721-131856743 AGGAGGGAGCAGAGAGGGGAGGG + Intergenic
1076702238 10:132279861-132279883 TGGCGTGATCACAGAGTGCAGGG - Intronic
1077377444 11:2211672-2211694 TGGAGTACACAGAGAGTGGCCGG - Intergenic
1078239182 11:9514657-9514679 TGAACTCACCAGAGAGTGAAGGG + Intronic
1079586376 11:22130269-22130291 TGAGGTGATCAGAGAGTGGTAGG - Intergenic
1080985407 11:37457947-37457969 TGAAGAGACCTGAGAGTAGAAGG - Intergenic
1081807628 11:45899145-45899167 TGGCCTGGCCAGAGAGTGGAAGG - Intronic
1081927173 11:46840653-46840675 TGGTGTGCCCAGAGAGGGCATGG + Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1082600117 11:55138686-55138708 TGGAGTGGGGAGAGGGTGGAGGG + Intergenic
1082807277 11:57459188-57459210 TGGAGGGAGCAGAGAATGAATGG + Intergenic
1083299891 11:61734820-61734842 TGGGGTGACAAGAGAGTTCAGGG - Intronic
1083349983 11:62020803-62020825 TGGAGTGGTCAGAGATGGGAAGG + Intergenic
1084583013 11:70036204-70036226 TGGAGTCACCAGGGACTGTACGG - Intergenic
1085021926 11:73215514-73215536 TGGAGCCACCAGAGAGTGTAAGG + Intergenic
1085177865 11:74506690-74506712 TGGATGGACAAGTGAGTGGATGG - Intronic
1085304391 11:75476898-75476920 TGGAGTGGCCAGGGGGTGGCAGG - Intronic
1085933850 11:81120614-81120636 TGGAGAGAGCAAAGAGTGAAAGG - Intergenic
1086913860 11:92505092-92505114 TGGATGGAGCAGTGAGTGGAGGG + Intronic
1087277054 11:96171149-96171171 TGGTGGGACCAGAAAGAGGATGG + Intronic
1089453568 11:118612775-118612797 TGGCTTGAAGAGAGAGTGGAAGG + Intronic
1089726566 11:120485731-120485753 TGGTGTGGTCAGAGAGTGGATGG + Exonic
1090975166 11:131673749-131673771 AGGAGAGCCGAGAGAGTGGAGGG - Intronic
1091192333 11:133706447-133706469 TGGAGAGAGCAGATTGTGGAGGG - Intergenic
1091375606 12:22937-22959 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1093504526 12:19849794-19849816 TGTTGTGACCAGAGGCTGGAAGG + Intergenic
1094104082 12:26790766-26790788 TGGAGTGCCCATAGAGTAGGTGG + Intronic
1094617112 12:32046009-32046031 TGGGGTCACAAGAGAGTGGACGG + Intergenic
1094686538 12:32721985-32722007 TGGTGTGCCCAGAGAGGGCACGG - Intronic
1095803997 12:46298024-46298046 AGGAGTGACCAGAAAGTGCTAGG + Intergenic
1095984849 12:47992593-47992615 TGGATTGCCCAGGGAGTGGGTGG + Intronic
1096159960 12:49367733-49367755 CGAAGTGCCCAGAGGGTGGAAGG + Intronic
1097318777 12:58202468-58202490 TGGAGACTCCGGAGAGTGGATGG + Intergenic
1098734800 12:74086471-74086493 TGTAGTTACCAAAAAGTGGAGGG - Intergenic
1098851327 12:75599998-75600020 TGGAGTGGGCAAAGTGTGGAGGG - Intergenic
1099036229 12:77590500-77590522 TGGGGTTATCAGAGGGTGGAGGG + Intergenic
1101571647 12:105959144-105959166 TGGTGTGCCCAGAGAGGGCATGG - Intergenic
1101737391 12:107473284-107473306 GGTAGTGACCAGAGGGAGGATGG - Intronic
1103209522 12:119156471-119156493 TGCAGAGACCAGAGAGAGGAGGG - Intronic
1103575115 12:121871718-121871740 GGGAGGGACCAGAGAGTTGGTGG + Intergenic
1104586358 12:130051088-130051110 GGGAGTGACCTGAGTGTGAAGGG - Intergenic
1104801620 12:131558618-131558640 AGGAAAGACCAGGGAGTGGAGGG - Intergenic
1104992710 12:132635126-132635148 AGGAGTGGCCAGAGAGTGGCTGG - Intronic
1106696130 13:32175397-32175419 GTGAGTGCCCAGAGGGTGGAAGG - Intronic
1109040158 13:57323876-57323898 TGGAAAGTCCAGAAAGTGGAAGG - Intergenic
1109172059 13:59108556-59108578 TGGAGTGAGCAGAGAGTGAAGGG - Intergenic
1111300056 13:86337194-86337216 GGGAGTTAAGAGAGAGTGGAGGG - Intergenic
1112226173 13:97542736-97542758 TGCAGTGACCAGGATGTGGACGG - Intergenic
1113523388 13:110955860-110955882 TTGAGTACCCAGAAAGTGGACGG + Intergenic
1113559791 13:111269585-111269607 AGGGCTGCCCAGAGAGTGGAGGG + Intronic
1113701916 13:112394636-112394658 TTGAGTACCCAGAAAGTGGACGG - Intronic
1114595200 14:23906181-23906203 TGGAGAGAAGAGAGAGTGAATGG - Intergenic
1114839826 14:26250181-26250203 TAGAGTGAGCAGACAGTGCAGGG + Intergenic
1115209673 14:30953293-30953315 TGGAGTGGCTAGTGACTGGAGGG - Intronic
1115323807 14:32114714-32114736 TGGAGTGACCTGAAATTGAAAGG + Intronic
1116941965 14:50799319-50799341 TGGAAGGACCAGAGTGTGGCTGG - Intronic
1117330547 14:54707702-54707724 GGGTGTGAGCAGAGAGTTGAAGG + Intronic
1117942430 14:60982187-60982209 TGGAGTGGGGAGAGAGAGGAGGG - Intronic
1119165577 14:72489682-72489704 TGGAGCCACCAGAAACTGGAAGG + Intronic
1119369720 14:74129126-74129148 TGGAGTGAGGAATGAGTGGAAGG + Intronic
1119613838 14:76085362-76085384 TGGAGTGACCACAGAGCAGAGGG + Intergenic
1120757314 14:88256307-88256329 TGGAGTGACCACAGATTCCAAGG - Intronic
1122470326 14:101961905-101961927 TGGAATTTCCAGGGAGTGGAGGG + Intergenic
1122594360 14:102879005-102879027 GGGGGTGCCCAGTGAGTGGAGGG + Intronic
1125891269 15:43268862-43268884 TGGAGTGAGAAGAGAGGAGATGG - Intergenic
1126171859 15:45701826-45701848 TGGGGTGACTAGAGAGGGTAGGG + Intergenic
1126253783 15:46600361-46600383 AGGAAGCACCAGAGAGTGGAGGG - Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126399018 15:48250194-48250216 AGGAGTGACTAGAAAGGGGAAGG - Intronic
1126508119 15:49431849-49431871 TGGAATGACAAGATAGTAGAAGG + Intronic
1127646585 15:60964827-60964849 TGGAGTGGCCACTGAGAGGATGG + Intronic
1127869609 15:63060347-63060369 TGGAAGAACCAGAGAGAGGAAGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129360479 15:75021013-75021035 TGGAGCTACCAGAGAGAGAAGGG - Exonic
1130295818 15:82646839-82646861 TGGAGTCACCTGAGTGTGGGGGG - Intronic
1130941264 15:88511230-88511252 TGGAGGGAATAGAGAGTAGAGGG - Intergenic
1131397377 15:92097419-92097441 TGGAGGGAACTGGGAGTGGATGG - Intronic
1131849759 15:96526189-96526211 TACAATGACCTGAGAGTGGAGGG - Intergenic
1131965869 15:97841582-97841604 TGTAGTTTCCAGAGACTGGAGGG - Intergenic
1132451319 15:101970062-101970084 GGGAGTGTGCAGAGACTGGAGGG + Intergenic
1132605614 16:792580-792602 TGCAATGACCAGTGAGTGCATGG + Exonic
1132738774 16:1400518-1400540 TGCAGGGACCAGGGAGGGGATGG + Intronic
1134589419 16:15440183-15440205 TGCAGTGAGCCGAGATTGGACGG + Intronic
1134878803 16:17726229-17726251 TGGAGTTGGCACAGAGTGGAAGG + Intergenic
1135323770 16:21513196-21513218 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1135885301 16:26300611-26300633 TGGTGTGTCCAGAGAGGGCATGG + Intergenic
1136335253 16:29606461-29606483 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1137319599 16:47367202-47367224 TGGAGTGCCCAGAGAGGGCATGG - Intronic
1137527447 16:49248900-49248922 TGGAGATGGCAGAGAGTGGATGG - Intergenic
1138544029 16:57705734-57705756 AGGAGAGATCAGAGGGTGGATGG - Intronic
1138956034 16:61971520-61971542 TGGCGTGCCCAGAGAGGGCAGGG - Intronic
1139352823 16:66348030-66348052 TAGAGTGACAAGAGTGTGGGTGG - Intergenic
1139396123 16:66640548-66640570 TGGAAGCACCAGAGAGTGGCAGG + Intronic
1140164816 16:72540260-72540282 TGGCATGCCCAGAGAGTGCATGG + Intergenic
1140252799 16:73309232-73309254 TGGGGCTACCTGAGAGTGGAGGG - Intergenic
1142035978 16:87862303-87862325 AGCAGTGACCAGAGAGCAGAGGG - Intronic
1142106759 16:88308520-88308542 TGCAGAGAACAGAGTGTGGAGGG - Intergenic
1143048807 17:4105103-4105125 TGGCTTGACCAGAGAGTTGAGGG + Intronic
1143139086 17:4730765-4730787 TGGAGTGAACGGAGCGTGGTGGG - Intergenic
1143376196 17:6469033-6469055 TGGAGGACCCAGAGAGTGTAGGG - Intronic
1143528514 17:7486256-7486278 AGGAGAGACCAGAGAGAGGAGGG + Intronic
1143793412 17:9316564-9316586 TGGCATGCCCAGAGAGTGCATGG + Intronic
1144360014 17:14483311-14483333 TGGAGTGGACAGAGAGAGAAAGG - Intergenic
1144403519 17:14929734-14929756 TGGAGTGAAGAGAGAGAGAAGGG - Intergenic
1144713791 17:17420587-17420609 TGACGGGAGCAGAGAGTGGAGGG + Intergenic
1145124178 17:20286719-20286741 TGCAGTGACCAGAGAGGTCAAGG - Intronic
1146045338 17:29500948-29500970 AGGAGTTACCAGAGACTGGGTGG + Intronic
1147166967 17:38598662-38598684 TGGAGTAACCCAAGACTGGAAGG - Intronic
1147522198 17:41184524-41184546 TGGTCTGACAACAGAGTGGACGG + Exonic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1147960837 17:44166763-44166785 GGGAGTTAGCAGGGAGTGGAAGG - Intergenic
1149665531 17:58362652-58362674 GGGAGTGAGCAGAGAGGGAAAGG + Intronic
1150762450 17:67974767-67974789 TGGTGTGCCCAGAGAGGGCATGG - Intronic
1150869378 17:68888796-68888818 AGGAGTGACCAGCCAGTAGAGGG + Intronic
1151577653 17:74960807-74960829 TGTAGGGACCAGAGTCTGGAAGG + Intronic
1152360673 17:79831839-79831861 TGGGGTGACCGGGGAGTGGGAGG + Intergenic
1152577260 17:81148319-81148341 TGGGGGCAGCAGAGAGTGGACGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152687312 17:81700930-81700952 GGGAGCACCCAGAGAGTGGAGGG - Intronic
1153961506 18:10143824-10143846 TGGAGAGACGCCAGAGTGGAAGG - Intergenic
1154323021 18:13369527-13369549 TGGAGGGAGATGAGAGTGGAAGG + Intronic
1155269181 18:24122827-24122849 TGGAGTGACCAGACGCTGTAAGG - Intronic
1157226877 18:45874220-45874242 TGGAATGTCCAGAGTGGGGAAGG + Intronic
1157415653 18:47500629-47500651 TGGAGTGTACAGAGGGGGGAAGG + Intergenic
1157478069 18:48036038-48036060 TGGGGTGACCAGAGCTAGGAAGG + Intronic
1158063199 18:53372773-53372795 AGGAGGCACAAGAGAGTGGAAGG - Intronic
1158769111 18:60493322-60493344 TGGATTGATCAAAGAGTGCAGGG - Intergenic
1159934317 18:74350243-74350265 TGGAGAGAACAGAGAGAGGAGGG - Intronic
1160633944 19:62485-62507 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1161323024 19:3649956-3649978 TGGCGTGAGCAGAGCGTGCAGGG - Intronic
1162577379 19:11506836-11506858 TGGAGGCACAAGAAAGTGGAAGG - Intronic
1163265596 19:16218790-16218812 TGGTGTGTCCAGAGAGGGCAAGG - Intronic
1163801779 19:19370184-19370206 TGGAGTGGCCAGAGAGGAGGGGG - Intergenic
1165946938 19:39449243-39449265 TGAGGTGAGCAGAGAGTGGTGGG + Intronic
1166349962 19:42192269-42192291 TGAAGTGACCAGGGAGTCAACGG + Intronic
1167131250 19:47587432-47587454 TGGGTTGACCAGAGACTGGCTGG + Intergenic
1168161525 19:54513313-54513335 TTGAGGGAGCAGAGAGAGGAAGG + Intergenic
1168317567 19:55490746-55490768 TGGGGTGAGCAGGGAGGGGACGG - Intronic
1168411199 19:56141407-56141429 GGGAGGGACCAGAGGTTGGATGG + Intronic
926756368 2:16239697-16239719 TGGAGAGACCAGTGACTGCAGGG - Intergenic
926892453 2:17650003-17650025 TGGAATGACCAGAACCTGGAAGG - Intronic
927802276 2:26112109-26112131 TGGCGTATCCAGAGAGGGGATGG - Intronic
927887853 2:26729519-26729541 TGAAGTGACCAGAGAGCAAAAGG + Exonic
928403522 2:30996558-30996580 TGGTGTGAATAGAGAGTAGAGGG - Intronic
929051617 2:37841835-37841857 TGGAGTGAGGGAAGAGTGGAAGG + Intergenic
930733111 2:54747264-54747286 TGCAGTGACCTGAGAGTCCAAGG + Intronic
931976078 2:67645779-67645801 TGGATTATCCAGGGAGTGGATGG + Intergenic
932818309 2:74879020-74879042 TGGAGGGACCATAGAGCTGAGGG + Intronic
933669225 2:84991002-84991024 TGGAGTGAGGCGAGAGTAGAAGG + Intronic
934780782 2:96968454-96968476 TGGAGGGACCAGACAGGGGCTGG - Intronic
935410803 2:102759886-102759908 CGGAGTGGCCAGAGAGAGAAAGG - Intronic
935765830 2:106366896-106366918 TGGGTTGACCTGAGGGTGGATGG + Intergenic
936284967 2:111174772-111174794 TGGTGGGACCAGAGAAAGGAAGG + Intergenic
936298687 2:111288047-111288069 TGGAGAGAGCCCAGAGTGGAGGG - Intergenic
936567534 2:113592543-113592565 GGGAGTGTGCAGAGACTGGAGGG + Intergenic
937095055 2:119229814-119229836 TGGAGTGGGCAGGGACTGGAAGG + Intronic
937115429 2:119401664-119401686 TGGCGTGTCCAGAGAGAGCATGG - Intergenic
937264848 2:120608919-120608941 TGGGGTGGCCAGGGAGTGGGAGG + Intergenic
938588067 2:132711277-132711299 TGCAGTGACCAAAGCCTGGAAGG - Intronic
939005762 2:136785157-136785179 TGCAGAGGCCAGTGAGTGGAAGG - Intronic
940538566 2:154980078-154980100 TGGAGTAAACAGTGACTGGAGGG + Intergenic
941520155 2:166532170-166532192 TGGAGTGACCAGAGACTAGAAGG - Intergenic
942289530 2:174455304-174455326 TGGACGGACCAAAGAATGGAAGG + Intronic
943799004 2:192034393-192034415 AGGAGTGATGGGAGAGTGGAAGG - Intronic
943851214 2:192725022-192725044 TGCAGTGAGCAGAGATTGGGAGG + Intergenic
945042561 2:205754542-205754564 TGCAGTGAACAGAGAAGGGAGGG - Intronic
945175355 2:207038215-207038237 TGGAGTTTCCAGAGATTGCACGG + Intergenic
945650279 2:212550124-212550146 TCTAGTAACCAGAGAGTGCAGGG - Intergenic
945670173 2:212793074-212793096 TGAAGTGACAGGAGAGTTGAGGG - Intergenic
947358503 2:229321721-229321743 TGGAGCGACCAGACTCTGGAAGG - Intergenic
947860296 2:233353627-233353649 GGGAGTGACCAGCGACTGGAGGG - Intergenic
948371785 2:237494257-237494279 GGCAGAGGCCAGAGAGTGGAGGG + Intronic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
1168810893 20:703894-703916 TGGAGTTGGCTGAGAGTGGAAGG + Intergenic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1170568723 20:17621123-17621145 TGGGCTGGCCAGAGAGTGGCAGG + Intronic
1170948540 20:20913174-20913196 TGGAGAGAGCAGAGAGAGTAGGG + Intergenic
1172153349 20:32806165-32806187 TGGAGTGAGCACAGAATGAAGGG - Intronic
1172429176 20:34876197-34876219 TGGAGTGACCAGAGTGGGGTGGG - Intronic
1172927471 20:38551904-38551926 TGGAGAGACCAGGGAGAAGAAGG + Intronic
1173963255 20:47091340-47091362 TGGAAACACCAGAGAGTGGCTGG - Intronic
1174334492 20:49849298-49849320 TGGAAAGACGGGAGAGTGGAGGG + Intronic
1174655578 20:52169549-52169571 TGGAGAGAGCAGAAAGTGGCAGG - Intronic
1174887207 20:54348916-54348938 GGGAGGGACCAGAGAGTACAGGG + Intergenic
1175366867 20:58461674-58461696 GGGAGTGAGGAGAGAGAGGAGGG - Intronic
1175600857 20:60271606-60271628 TGGAGGGTCCAGAGAGGGAAGGG + Intergenic
1175647094 20:60684166-60684188 TGGAGAGAGCAGGGAGTGAAAGG + Intergenic
1175708614 20:61201779-61201801 TGGAGTGTCCTGAGTGAGGATGG - Intergenic
1177652914 21:23981278-23981300 TGGAGTTACCAGAAAATAGATGG + Intergenic
1178265751 21:31141605-31141627 AGGACTGAGCAGAGAGTGGGTGG + Intronic
1179924466 21:44526713-44526735 TGTAGAGTCCAGGGAGTGGACGG + Intronic
1182093767 22:27612941-27612963 TGGAGGGACAGGGGAGTGGATGG + Intergenic
1183111678 22:35654110-35654132 TGGTGTGCCCAGAGAGGGCATGG - Intronic
1184669188 22:46003915-46003937 TGGAGTCAGCAGAGGCTGGAAGG - Intergenic
1184731141 22:46371804-46371826 TGGAGAGATGAGTGAGTGGATGG - Intronic
1184731188 22:46372019-46372041 TGGAGAGACGAGTGAGTAGATGG - Intronic
1185076106 22:48683558-48683580 TGGAGGAACCAGCGAGTGCACGG - Intronic
949981109 3:9502140-9502162 TGGAGTGACGAGAGGGCAGAAGG + Exonic
950449772 3:13059073-13059095 TGGTGTCACCAAAGGGTGGAGGG - Intronic
950639568 3:14340062-14340084 GGGAGTGGGCAGAGAGTGGCTGG + Intergenic
950965200 3:17141260-17141282 TGGTGTGCCCAGAGCCTGGAGGG + Intergenic
952014544 3:28941168-28941190 TGGAGACACCACAGAGAGGAAGG - Intergenic
953371397 3:42391608-42391630 TGGATTGAACAGAGAGGGGAAGG + Intergenic
953813716 3:46135684-46135706 TGGGGTGAGCAGAGAGAGGGAGG - Intergenic
954196073 3:48998003-48998025 TGGAGTGAGGAGGGGGTGGAGGG + Intronic
954455859 3:50599505-50599527 AGGAGTGACCTGAGGGTGGGAGG + Intergenic
955958589 3:64316310-64316332 TGGCGTGCCCAGAGAGGGCATGG + Intronic
961931337 3:130536698-130536720 TGGAGTGGTGAGAGAGAGGAAGG + Intergenic
962196037 3:133364597-133364619 TAGAGTGACCAGAACCTGGAAGG + Intronic
962326727 3:134440656-134440678 TGGTGTGACCAGGGAGGGCATGG - Intergenic
962693225 3:137922338-137922360 TGGATTGACCAGAAATTAGAAGG + Intergenic
962966114 3:140356062-140356084 TGGAGATACCACAGAATGGAAGG - Intronic
963726044 3:148922892-148922914 TGGCATGACCAGAGAGGGCATGG + Intergenic
965654098 3:170965387-170965409 TGGAGAGAGAAGATAGTGGAAGG + Intergenic
965838059 3:172872691-172872713 GGGAATGAACAGAGAATGGAGGG - Intergenic
967218570 3:187230147-187230169 TGCTGTGACCAGAAAGTGCATGG - Intronic
967574783 3:191077106-191077128 TGGAGTGCCTGGAGAGGGGAGGG + Intergenic
968231172 3:197005584-197005606 AGGAGTGGCCAGAGAGTGAGAGG + Intronic
968271094 3:197404300-197404322 TGGGGAGAGCAGGGAGTGGAGGG + Intergenic
968442475 4:630887-630909 TGGAAGGACCAGGGAGTGAATGG + Intronic
968707218 4:2085374-2085396 TTGAGTGACTAGATGGTGGATGG - Intronic
969040317 4:4290466-4290488 TCGAGTGCCCAGAGACGGGAAGG - Intronic
969080150 4:4611724-4611746 TGGAGAGACACGTGAGTGGATGG + Intergenic
970212107 4:13720579-13720601 TGGTGTGCCCAGAGAGGGCATGG - Intergenic
970677298 4:18465541-18465563 TGGTGTGCCCAGAGAGAGCATGG - Intergenic
973669343 4:53199719-53199741 TGGAATGACCAGAAAGGGCATGG + Intronic
973898663 4:55443638-55443660 TGGAGTGATCAGTGGTTGGAAGG - Intronic
974823110 4:67093069-67093091 TGAAATGAGCAGAGAGAGGAGGG + Intergenic
974829884 4:67176845-67176867 TGGAGTGAATAGAGAGGGAAAGG - Intergenic
975191771 4:71472101-71472123 TGGACAGACCAGAGAGAGCAAGG - Intronic
977146791 4:93452411-93452433 TGGAGTAACCAGAGAGTAGAGGG + Intronic
978305705 4:107326047-107326069 TGGAGATACCAGAGGGTGGGAGG - Intergenic
978558339 4:110005103-110005125 TGCAGTGAGCAGTGAGTGGTTGG - Intronic
978881425 4:113707940-113707962 TGTATTCACCAGAGAATGGAAGG - Intronic
982288020 4:153754818-153754840 TGGAGTCACCAGAGACTGGAAGG + Intronic
983253563 4:165373510-165373532 TGGGGTGGGGAGAGAGTGGAGGG - Intronic
983357764 4:166685652-166685674 TGCAGAGACCAGAGAGTCGGGGG - Intergenic
984874633 4:184356353-184356375 TGTAGTGACCAGATAATTGAGGG - Intergenic
985635758 5:1034977-1034999 GGGAGGGACAAGTGAGTGGATGG + Intronic
986132380 5:4943129-4943151 AGGAGAGGCCAGAGAGGGGAAGG + Intergenic
986521839 5:8627727-8627749 TGGAGTGAGCGCAGAGTGAAGGG + Intergenic
986685498 5:10272452-10272474 TGGAGGGAGCAGAAGGTGGAAGG - Intergenic
988864366 5:35318270-35318292 TGGACTGAGCACAGAGTGGGAGG - Intergenic
990488567 5:56282394-56282416 TGTTGTGACCAGAGGCTGGAAGG + Intergenic
992978737 5:82143382-82143404 TGGAGACACGAGAGTGTGGAAGG + Intronic
993225746 5:85165897-85165919 TGGAGTGATCAGGCAGTGGGAGG + Intergenic
993322553 5:86490410-86490432 TGGTGTGAAAAGAGAGTGAATGG - Intergenic
996029305 5:118687169-118687191 TGCAGTGACCTGAGAGCAGAGGG + Intergenic
996309182 5:122083672-122083694 TGGAGTGAAGGCAGAGTGGAAGG + Intergenic
997101516 5:130974414-130974436 TAGAGAGAAGAGAGAGTGGAAGG - Intergenic
997208879 5:132066293-132066315 TGGAGAGGCCAGAGTGTGGCTGG + Intergenic
997548526 5:134732188-134732210 TGCATTGAACAAAGAGTGGAAGG - Intergenic
998177476 5:139910888-139910910 TGGAGAGAGCAGAAGGTGGAAGG + Intronic
1000523537 5:162327736-162327758 TGGTGTGATCACAGAGAGGAAGG + Intergenic
1000663856 5:163970505-163970527 TGGAGTGAGCAAGGAGTGAATGG - Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001235714 5:170027675-170027697 TGGAGTGCCCAGAGAGTGAAGGG - Intronic
1001374958 5:171247626-171247648 TGGGGTGGGCAGAGAATGGATGG - Intronic
1001412647 5:171521739-171521761 GGGATTGACCAGTGAGGGGATGG + Intergenic
1001523998 5:172415695-172415717 TGGAGTGCCCAGAGAGCTGAGGG - Intronic
1001688857 5:173616890-173616912 GGAAGTGAGCAGAGAGTGGGCGG - Intergenic
1002780201 6:359447-359469 TGGGGAGACCAGAGACTAGAAGG + Intergenic
1003061525 6:2866462-2866484 TGGAGTGTCTAGAGAGGGAATGG + Intergenic
1003636129 6:7833030-7833052 TGCAGTGTGGAGAGAGTGGATGG + Intronic
1003964870 6:11243157-11243179 TGCCATGACCAGAGAGTGGGTGG + Intronic
1004327444 6:14688271-14688293 TGGAGTGACCATAGTGTGCCAGG + Intergenic
1004847415 6:19660661-19660683 TCATGTGACCAGAGACTGGAGGG + Intergenic
1005373264 6:25156599-25156621 TTGAATGACCAGATAGAGGAAGG - Intergenic
1005562670 6:27056670-27056692 GGGAGGTACCAGAGGGTGGAGGG - Intergenic
1006378511 6:33684722-33684744 TGGTGTGACAGGAGAGTGGAAGG - Intronic
1006987150 6:38183481-38183503 GGGAGCGAGCAGTGAGTGGAAGG - Intronic
1008213904 6:48761167-48761189 TGGAGTGACTAATGAGTGTAAGG + Intergenic
1008698129 6:54065678-54065700 TGGAAACACAAGAGAGTGGAGGG - Intronic
1009185672 6:60571864-60571886 TGGGGAGACCAGAGAGAGAAAGG - Intergenic
1011547541 6:88498088-88498110 TGGAGTGAGCAGATATAGGATGG - Intergenic
1012552236 6:100474339-100474361 TGCAGTGACCAGAATGTGGTGGG + Intergenic
1012890100 6:104887566-104887588 TGGAGTGATAAGAGAGGTGAGGG - Intergenic
1014145172 6:117989146-117989168 GGGAGTGGACAGGGAGTGGAGGG - Intronic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1017588126 6:155948584-155948606 GGAAGTAACAAGAGAGTGGAAGG + Intergenic
1018635943 6:165859567-165859589 TGGCGTGCCCAGAGAGGGCAGGG - Intronic
1018986342 6:168640122-168640144 TGGAGGGAACAAAGACTGGAGGG - Intronic
1019118977 6:169788249-169788271 TGGAATGAGCAGAGATTCGAGGG - Intergenic
1019657954 7:2207570-2207592 TGGTGTGCCCAGAGAGGGCATGG + Intronic
1019805004 7:3117298-3117320 GGGAGTGACCACAGAATGGGAGG + Intergenic
1020036520 7:4966634-4966656 TGGTGTGCCCAGAGAGGGCATGG + Intergenic
1021492273 7:21232184-21232206 TGGGGTGAGGAGAGAGGGGAGGG - Intergenic
1021697134 7:23286361-23286383 AGGAGGGAGGAGAGAGTGGAAGG - Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1021877879 7:25065215-25065237 TGGTGTGCCCAGAGAGGGGATGG + Intergenic
1021948961 7:25755342-25755364 TGGGGTTACCAGACATTGGATGG - Intergenic
1022462308 7:30621499-30621521 TGGAGTGACCAGAAAGGATATGG - Exonic
1022503284 7:30895782-30895804 TGGGGTGACCACAGTGTGGGAGG + Intergenic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023915869 7:44588830-44588852 TGGAGCCACCAGAAACTGGAAGG + Intergenic
1025204253 7:56982637-56982659 TGGAGCCACCAGAGGCTGGAAGG + Intergenic
1025667686 7:63594297-63594319 TGGAGCCACCAGAGGCTGGAAGG - Intergenic
1026394616 7:69938665-69938687 TGCAATGAGCAGAGAGGGGATGG + Intronic
1026413422 7:70152223-70152245 TGGAGTCTCCAGAGAGAGGAGGG + Intronic
1027559260 7:79706736-79706758 TGGGGTGAGGAGAGAGTGGGAGG - Intergenic
1027795158 7:82683522-82683544 TGGACTGAAAAGAGAGTGGTAGG - Intergenic
1027956736 7:84887956-84887978 TGCAGACACCAGAGAGTGCATGG - Intergenic
1028510582 7:91621017-91621039 GGGAGTGGCCAGAGCATGGAGGG - Intergenic
1028928909 7:96391264-96391286 AGGAGTGATCTGAGAGAGGATGG - Intergenic
1029050286 7:97679790-97679812 TGGTGTGCCCAGGGAGGGGATGG + Intergenic
1030298332 7:107951180-107951202 TGACTTGATCAGAGAGTGGAGGG - Intronic
1030497143 7:110314444-110314466 TGGAGTGAACAAGGAGGGGAAGG - Intergenic
1031877475 7:127158348-127158370 TCCACTGACAAGAGAGTGGACGG - Intronic
1031928897 7:127664477-127664499 TGGTGTGCCCAGAGAGGGCATGG + Intronic
1032010032 7:128339801-128339823 TGGAGTGGGGAGGGAGTGGAGGG + Intronic
1032437382 7:131911188-131911210 TGGAGTGAAGAGCGGGTGGAAGG - Intergenic
1034318369 7:150155795-150155817 AGGAATGAGCAGAGAGGGGAGGG - Intergenic
1034774382 7:153811437-153811459 AGGAATGAGCAGAGAGGGGAGGG + Intergenic
1035244287 7:157552089-157552111 TGCAGTGGCCATAGAGTGCATGG - Intronic
1035312345 7:157977495-157977517 TGGAGGGCCCAGAGCGTGCAAGG + Intronic
1036473132 8:9068773-9068795 TTGAGTGACCAGAGAGTGATTGG + Intronic
1036630627 8:10511736-10511758 TGGTGTGCCCAGAGAGGGCATGG - Intergenic
1037586013 8:20276506-20276528 TGGCGTGCCCAGAGAGGGCATGG + Intronic
1038094873 8:24297064-24297086 TGGAGTGACAGGAGTTTGGAAGG + Intronic
1038406286 8:27325265-27325287 TGGAGTGGACAGAGGATGGAGGG + Intronic
1038509526 8:28118447-28118469 TTGAGTGAACAGAGAGTTCAAGG + Intronic
1038726493 8:30086813-30086835 TGGAGTGCCCAGCGAGGGCATGG - Intergenic
1038752905 8:30313490-30313512 TGGAGGGACCAGTGAGAGCAAGG + Intergenic
1039547023 8:38417724-38417746 TGGGGTTACCTGGGAGTGGAGGG - Intronic
1046388566 8:113537244-113537266 TGGGGCTATCAGAGAGTGGAGGG - Intergenic
1047022857 8:120794906-120794928 TAGACTGACCAGAAAGTAGATGG - Intronic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048868739 8:138780201-138780223 TGGAGTGAGAAGAGAGTCTAGGG + Intronic
1049277087 8:141725308-141725330 TGGAGGGTCCAGAAAGGGGAAGG - Intergenic
1049397560 8:142408354-142408376 TGGAGTAACCAGTGAGCCGAGGG + Intergenic
1049710867 8:144062768-144062790 TGGAGTGAACAGAGAGGCGAGGG - Intronic
1049884999 9:20990-21012 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1051570246 9:18548594-18548616 TGTTGTGACCAGAGACTTGAAGG + Intronic
1052325900 9:27216520-27216542 TGGTGTGGACAGAGAGTGAAGGG + Intronic
1053474387 9:38371473-38371495 TGGTGGGGCCAGAGCGTGGAAGG + Intergenic
1053786715 9:41657638-41657660 AGGAGTCCCCAGAGAGTTGAGGG - Intergenic
1054465616 9:65491412-65491434 TGGGGAGACCAGAAAGTGGCAGG - Intergenic
1055048935 9:71960206-71960228 AGGAGGGACCAGGGAATGGAGGG + Intronic
1056554488 9:87677384-87677406 TCGAGTCTCCTGAGAGTGGAAGG + Intronic
1057577313 9:96253575-96253597 TGGAGTGACCAGAGAGTGGATGG - Intronic
1057795128 9:98150353-98150375 TGCTGTGACCACAGAGTGGTGGG - Intronic
1059250428 9:112883153-112883175 TGGAGTGAGAAGAAAGTGAATGG + Intronic
1060226863 9:121797111-121797133 AGGAGTCAACAGAGAATGGATGG - Intergenic
1060403718 9:123362555-123362577 TGCAGGGACAAGACAGTGGAGGG + Intronic
1060411042 9:123400466-123400488 TGGACTGGCCAGAGAGTGGCTGG + Intronic
1060574197 9:124674290-124674312 TGGAGTTCCCAAAGAGTGTAAGG - Intronic
1061096221 9:128458118-128458140 TGGAGCGACCAGGGGGTGGCAGG - Intronic
1061196256 9:129108687-129108709 TGGAGTGGGCAGAGACAGGAGGG + Intronic
1062185435 9:135215861-135215883 GGGAGTGGCCAGAGAGGAGAGGG + Intergenic
1187190886 X:17033891-17033913 GGAAATGGCCAGAGAGTGGAGGG - Intronic
1187890236 X:23927749-23927771 GGGACTTACCAGAGGGTGGAAGG - Intronic
1192597687 X:72428670-72428692 TGGAGTGACCTTAGACTGGAAGG - Intronic
1194678592 X:96824037-96824059 TAGAATGATCAGAGTGTGGAGGG - Intronic
1196001461 X:110791446-110791468 TGGAGAAAGCAGAGAGTGGCAGG - Intronic
1198139385 X:133787559-133787581 TGGACTAAACAGAGAGTGGCAGG + Intronic
1198662237 X:138982149-138982171 AGGTGTGACCAGAGAGAGGTTGG + Intronic
1199526801 X:148801862-148801884 TGTATTGAGGAGAGAGTGGAAGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1201392600 Y:13514567-13514589 TGGGGTGGGCAGAGAGGGGAAGG - Intergenic