ID: 1057581189

View in Genome Browser
Species Human (GRCh38)
Location 9:96289221-96289243
Sequence ATGTGTGTGTGTATGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057581186_1057581189 9 Left 1057581186 9:96289189-96289211 CCTGGTGTGTGTGTGTGTGTGTG 0: 243
1: 2580
2: 2533
3: 3966
4: 6713
Right 1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057581189 Original CRISPR ATGTGTGTGTGTATGGAAGT GGG Intronic
No off target data available for this crispr