ID: 1057582991

View in Genome Browser
Species Human (GRCh38)
Location 9:96304081-96304103
Sequence CTGTATTTAGAGATGGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057582985_1057582991 13 Left 1057582985 9:96304045-96304067 CCCGTTTTTCTATGTGGTTTTTG No data
Right 1057582991 9:96304081-96304103 CTGTATTTAGAGATGGTTTCAGG No data
1057582986_1057582991 12 Left 1057582986 9:96304046-96304068 CCGTTTTTCTATGTGGTTTTTGG No data
Right 1057582991 9:96304081-96304103 CTGTATTTAGAGATGGTTTCAGG No data
1057582984_1057582991 17 Left 1057582984 9:96304041-96304063 CCTGCCCGTTTTTCTATGTGGTT No data
Right 1057582991 9:96304081-96304103 CTGTATTTAGAGATGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057582991 Original CRISPR CTGTATTTAGAGATGGTTTC AGG Intergenic
No off target data available for this crispr