ID: 1057584630

View in Genome Browser
Species Human (GRCh38)
Location 9:96318147-96318169
Sequence GCTTTTAAGAGGCTTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057584630_1057584637 0 Left 1057584630 9:96318147-96318169 CCCTCCAGAAGCCTCTTAAAAGC No data
Right 1057584637 9:96318170-96318192 ACATTGAAGGCTGGGCACAGTGG No data
1057584630_1057584635 -9 Left 1057584630 9:96318147-96318169 CCCTCCAGAAGCCTCTTAAAAGC No data
Right 1057584635 9:96318161-96318183 CTTAAAAGCACATTGAAGGCTGG No data
1057584630_1057584638 28 Left 1057584630 9:96318147-96318169 CCCTCCAGAAGCCTCTTAAAAGC No data
Right 1057584638 9:96318198-96318220 ACCTGTAATCCCTACACTTTAGG 0: 42
1: 6441
2: 100333
3: 323700
4: 234414
1057584630_1057584636 -8 Left 1057584630 9:96318147-96318169 CCCTCCAGAAGCCTCTTAAAAGC No data
Right 1057584636 9:96318162-96318184 TTAAAAGCACATTGAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057584630 Original CRISPR GCTTTTAAGAGGCTTCTGGA GGG (reversed) Intergenic
No off target data available for this crispr