ID: 1057588266

View in Genome Browser
Species Human (GRCh38)
Location 9:96348774-96348796
Sequence ACAATCTAAAAGGGTAAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057588266_1057588272 14 Left 1057588266 9:96348774-96348796 CCCGATTTACCCTTTTAGATTGT 0: 1
1: 0
2: 2
3: 12
4: 222
Right 1057588272 9:96348811-96348833 TACATATGTGAAGCACGGACTGG No data
1057588266_1057588273 29 Left 1057588266 9:96348774-96348796 CCCGATTTACCCTTTTAGATTGT 0: 1
1: 0
2: 2
3: 12
4: 222
Right 1057588273 9:96348826-96348848 CGGACTGGATTTCTGATCACTGG No data
1057588266_1057588270 9 Left 1057588266 9:96348774-96348796 CCCGATTTACCCTTTTAGATTGT 0: 1
1: 0
2: 2
3: 12
4: 222
Right 1057588270 9:96348806-96348828 GTCCTTACATATGTGAAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057588266 Original CRISPR ACAATCTAAAAGGGTAAATC GGG (reversed) Intronic
907180437 1:52565027-52565049 ATAATCTCACAGGGTAAATGGGG - Intergenic
907429329 1:54402903-54402925 ACAAGCTTAAAGGGTAAAGTGGG + Intronic
907890634 1:58633146-58633168 CCATTCTAAAAGGGTAAAATAGG - Intergenic
908040190 1:60104444-60104466 ACATTATAAAAGGGCAAATTTGG + Intergenic
910418285 1:87025484-87025506 AGAGTATAAAAGGGTAAATTTGG + Intronic
911329093 1:96506179-96506201 AGTATCTAAAAGGATAACTCTGG + Intergenic
911368207 1:96965887-96965909 ACAAACTAAAAGGTTGAATCAGG + Intergenic
911696186 1:100892865-100892887 AGCATCTAAAAGGGTCAAACAGG + Intronic
912851155 1:113126073-113126095 ACAATCAGAAATGGTGAATCTGG - Exonic
913733126 1:121738905-121738927 ACAATCTGAAAGGGGAGATTTGG - Intergenic
913787300 1:122470984-122471006 ACAATCTGAAAGGGGAGATTTGG + Intergenic
918139206 1:181706141-181706163 AAAATGTAAAAGGGGGAATCTGG - Intronic
918451326 1:184661876-184661898 GGAAGCTAAAAGGGTAAACCTGG - Intergenic
919337553 1:196257372-196257394 ACAAGAGAAAAGGGTAAATATGG + Intronic
919557761 1:199081854-199081876 ACAATCTCAAAGGCAAAATGTGG + Intergenic
920391913 1:205610339-205610361 ACAGTTTAAAAGGATAAATTAGG + Exonic
921669615 1:217911754-217911776 ACAATGCAAAAGGAAAAATCTGG - Intergenic
922491908 1:226024461-226024483 ACAAACTAAATGAGTAAATGTGG - Intergenic
923154021 1:231259855-231259877 ACAATGAAAATGGGCAAATCAGG + Intronic
923916584 1:238512497-238512519 AGGATCTAAATGGGAAAATCAGG - Intergenic
1066177043 10:32918385-32918407 ATAATTTAAAAGGGAAAAACTGG + Intronic
1066530557 10:36333648-36333670 CCAAGCTAAATGGGAAAATCTGG - Intergenic
1067984907 10:51132198-51132220 AAGAACTAAAAGTGTAAATCAGG - Intronic
1068586195 10:58801694-58801716 ACACTCTAGAAGGGTATACCAGG - Intronic
1068820697 10:61375083-61375105 ACAATCAAAAAGGACAAATTAGG - Intergenic
1069269643 10:66509842-66509864 CCAAGCCAAAAGGGTAAAACTGG - Intronic
1073737587 10:106367510-106367532 ACAATATAAATGGATTAATCAGG + Intergenic
1074874823 10:117605624-117605646 ACAATAAAAAAGGGTAGATGAGG - Intergenic
1078868212 11:15318469-15318491 AAAATCTAAAAAGGAAAAACAGG + Intergenic
1079149353 11:17883929-17883951 ACATTCTAAACGGGGAAATCGGG + Intronic
1079467513 11:20745348-20745370 ACAATCTAAATGGATAATTATGG + Intronic
1079478410 11:20856208-20856230 ACAAACTAAAAAGGATAATCTGG - Intronic
1080422413 11:32122609-32122631 ACAATCTTAAAGGGTAAATGTGG + Intergenic
1087379817 11:97391009-97391031 ACAATATAAAAGGGAAGATGTGG - Intergenic
1087632331 11:100664927-100664949 ACTTTATAAAAGGGTAAATTGGG - Intergenic
1087845443 11:102966866-102966888 ACAGTTTCAGAGGGTAAATCTGG + Intergenic
1088057276 11:105599638-105599660 ACAATCTAAAAGGGTTAATAAGG + Intergenic
1088072630 11:105809367-105809389 AATAACTAGAAGGGTAAATCTGG - Intronic
1088953777 11:114598101-114598123 ACATTCTAAAAGGGAAAAATTGG + Intergenic
1092600748 12:10060869-10060891 AAAATATAAATTGGTAAATCTGG + Intronic
1092630240 12:10368721-10368743 AAAATATAAAAAGGGAAATCAGG + Intergenic
1092639657 12:10490929-10490951 ACAATGCAAAAGAATAAATCAGG + Intergenic
1093392550 12:18640230-18640252 ACAGTTTAAAAGAGTAAAGCTGG - Intronic
1095072536 12:37871950-37871972 ACAATCTGCAAAGGTAAATTTGG - Intergenic
1095074661 12:37903395-37903417 AGAATCTGAAAGGGAAAATTTGG - Intergenic
1095240717 12:39855911-39855933 ACAATCTAAAAGAGTCACTGAGG + Intronic
1096390591 12:51225784-51225806 ACCACCTGAAAGGGTAAATATGG + Intergenic
1096909915 12:54973150-54973172 CCAATCTAAAGGGGGAAGTCAGG + Intronic
1098339697 12:69439240-69439262 ACAATCTAAAAAGGAAAAAAAGG + Intergenic
1099631631 12:85155449-85155471 AGAATCTAGTAGTGTAAATCTGG + Intronic
1100398629 12:94207391-94207413 ACAAGCAAAAAGTTTAAATCTGG - Intronic
1106753005 13:32794257-32794279 CCATTTTAAAAGGGTAACTCTGG - Intergenic
1107740036 13:43440089-43440111 AATATCTAAAAGGGTGAATTAGG + Intronic
1108295484 13:49013018-49013040 AAGATCTAAAAGGGTAAGCCAGG + Intronic
1108620235 13:52175564-52175586 ACACTCTAAAAGTGAATATCTGG + Intergenic
1108666508 13:52637498-52637520 ACACTCTAAAAGTGAATATCTGG - Intergenic
1109994017 13:70098649-70098671 ACAATTTAAAAGGGCATCTCTGG - Intronic
1110889577 13:80681607-80681629 ACAATCTACAAGGCTACATATGG - Intergenic
1111005797 13:82246808-82246830 AGAATCTACAAGGGAAGATCCGG - Intergenic
1112055359 13:95685358-95685380 CCATTCCAAAAGGGTAAAACCGG - Intronic
1112491596 13:99870179-99870201 ATAAGCCAAAAGGGAAAATCTGG + Intronic
1113393996 13:109926862-109926884 ACAATCTGAAAGGAATAATCTGG + Intergenic
1114769798 14:25415920-25415942 ACAATGTAAAGAGGTAAATTGGG - Intergenic
1115576701 14:34718276-34718298 ACTATCTAAAACAGTGAATCTGG + Intergenic
1116568926 14:46489944-46489966 ACAATCTACTAGGCTAAATTTGG - Intergenic
1118929799 14:70230774-70230796 AGAATCTGAAAAGGTAAAACTGG + Intergenic
1118954789 14:70470649-70470671 AGAATCTGAAAAGGTAAAACTGG - Intergenic
1121611090 14:95280629-95280651 AATATCTAAAAGGATTAATCAGG - Intronic
1125427106 15:39559960-39559982 AGAAACTAAAAGGGAAAAACTGG - Intergenic
1126018014 15:44372100-44372122 ACTCTCTAAAAGAGAAAATCTGG + Intronic
1126247103 15:46520015-46520037 ACAATATAAAAAGATAAATAGGG + Intergenic
1127242504 15:57132695-57132717 ACAATTTAAAAAGAAAAATCAGG - Intronic
1127742633 15:61927568-61927590 ACAGTGTAAAAGTGTAAAACAGG - Intronic
1128206584 15:65858108-65858130 ACATTTTAAAAGGAAAAATCTGG - Intronic
1130521229 15:84662074-84662096 AGAATCTTTAAGGGAAAATCAGG + Intergenic
1132910987 16:2311270-2311292 ACAACATAAAAGGGTAAATAGGG - Intronic
1133801526 16:9089924-9089946 ACTATCTAAAATGCTAAATTAGG - Intergenic
1134418675 16:14066969-14066991 ACAAACAAAATGGGTAATTCTGG - Intergenic
1135072764 16:19366614-19366636 ACAGTCTACAAGGTTAAGTCTGG - Intergenic
1135489009 16:22891806-22891828 ACAACCTCAAAGAGAAAATCAGG - Intronic
1135719063 16:24799262-24799284 GCAATCCAAAAGGGTAAAATTGG + Intronic
1136052134 16:27659210-27659232 ACTATTTAAATGGGTAAATTTGG + Intronic
1137283202 16:46995475-46995497 CCAGTCTCAAAGGGTAAAACAGG + Intergenic
1139079729 16:63501653-63501675 ACAAACTAAAATGTTAAATGTGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140335016 16:74096903-74096925 ACAATCCACATGGGAAAATCAGG - Intergenic
1142507803 17:376200-376222 ATAATCTAAAAGGGAAAAAATGG + Intronic
1142558949 17:798660-798682 CCACTCTAAAAGGGGAATTCTGG + Intergenic
1143424242 17:6821171-6821193 ACCATATCAAAGGGTATATCTGG - Intronic
1144444617 17:15315376-15315398 ACAATTTAAAAGGATCATTCTGG + Intronic
1144748121 17:17629351-17629373 ACACTTTAAAATGGTTAATCTGG - Intergenic
1145365230 17:22257856-22257878 ACAATCTACAAGGGGACATTTGG - Intergenic
1150348983 17:64427394-64427416 AACATCTAAAAGGATTAATCAGG + Intergenic
1150889991 17:69137033-69137055 CAAATCTAAAAGTATAAATCTGG + Intronic
1151501527 17:74493004-74493026 AAAAAAAAAAAGGGTAAATCTGG - Intergenic
1152213170 17:79014953-79014975 ACCATCTAAAATGATTAATCAGG - Intergenic
1153206379 18:2707440-2707462 ATATTTTAAAAGGTTAAATCTGG - Intronic
1156075299 18:33269283-33269305 ACAAACTAAAAAGGGAAAGCTGG + Intronic
1157174154 18:45435874-45435896 ACATTTTAATAGGTTAAATCAGG - Intronic
1160000148 18:75010550-75010572 ACAATCAGATATGGTAAATCGGG + Intronic
1161271371 19:3391305-3391327 ACAATCTAAAAATGTAGTTCTGG + Intronic
1163200691 19:15766691-15766713 ACAAACAAAAAGAATAAATCTGG - Intergenic
1164111861 19:22170811-22170833 TCAAACTAAAAGAATAAATCTGG - Intergenic
1164497002 19:28775244-28775266 ACAATCAAAAAAGATAAATAAGG + Intergenic
1165893801 19:39129969-39129991 ATAATCTACAAGGGTAGAGCTGG - Intronic
1166128950 19:40733946-40733968 ATATTATAAAAGGGTAAATGTGG + Intronic
1166435381 19:42762941-42762963 ACAATCACAAAGGGGAGATCAGG - Intronic
925440365 2:3880228-3880250 ACAAACAAAAAGGGAAAATTTGG - Intergenic
927572671 2:24173860-24173882 CCAATCTAACAGGGTTAATGAGG - Intronic
927590511 2:24353126-24353148 ACAAACTTAAAAGGTAAATGGGG + Intronic
932708028 2:74041892-74041914 AAAATCTAAAAGGGTAAACAGGG - Intronic
938502824 2:131840500-131840522 ATAATATAAAAGGGAAAATAAGG - Intergenic
938748022 2:134299304-134299326 ACAATCTAAAACTAAAAATCTGG - Intronic
939656649 2:144834737-144834759 ACAATTTAAAAAAGTAAATGTGG + Intergenic
940001838 2:148974290-148974312 ACAATAGAAAAGATTAAATCAGG - Intronic
940444143 2:153756689-153756711 ACATTCTAAAATGGTAAACCTGG - Intergenic
941419920 2:165270994-165271016 ACAATCTTAGAAGGTAGATCAGG - Intronic
942796649 2:179828610-179828632 ACAATCAAAAAGGGAAGATTTGG + Intronic
943916881 2:193646073-193646095 ACAATGTAAGAGGTTAAAACTGG + Intergenic
944627041 2:201581390-201581412 ACAACCTAAAAGTGTAAGTGTGG + Intronic
944825518 2:203479300-203479322 ACTTTCTAAAAGCCTAAATCTGG + Intronic
944852077 2:203730001-203730023 AGAAGCTAAATGGGTAAATTAGG + Intronic
945167121 2:206957964-206957986 ACAAGCTAAAAGGCTAAATATGG - Intronic
945444832 2:209924681-209924703 AAAATCTTAAAAGGCAAATCTGG - Intronic
946083345 2:217146799-217146821 ACCTTCTAACAGGGTAACTCAGG + Intergenic
946787497 2:223263230-223263252 ACATTCTAAAAGGATGACTCAGG + Intergenic
1173838858 20:46143792-46143814 ACATTTTAAAAGGGTGAATTTGG + Intergenic
1175510364 20:59520041-59520063 CCATTCTAACAGGGAAAATCAGG - Intergenic
1177093968 21:16807916-16807938 AGCATCTTAAAGGGTAATTCTGG + Intergenic
1180243956 21:46533843-46533865 ATAATTTAAAAAGGTACATCCGG - Intronic
951087846 3:18535568-18535590 AGAAAGTGAAAGGGTAAATCAGG + Intergenic
956102478 3:65783346-65783368 ACAATCAAAAAGGCAAAATAAGG + Intronic
957423459 3:80003207-80003229 ACAATCTCAAAGGAAGAATCAGG - Intergenic
957897245 3:86438596-86438618 ACAATATATTATGGTAAATCTGG + Intergenic
957952080 3:87140536-87140558 ACAATGTCAAAAGGAAAATCTGG - Intergenic
958243195 3:91110154-91110176 AGAATCTGAAAGTGTATATCTGG + Intergenic
958405640 3:93755092-93755114 ACAATCTACAAGTGTATATTTGG - Intergenic
958456515 3:94338415-94338437 ACAATTTAAAAGGCTCACTCTGG - Intergenic
959889499 3:111538746-111538768 ACATTTTAAAAGGATAAATTGGG - Intronic
960248196 3:115422761-115422783 ACATTTTAAAAGGATAACTCTGG + Intergenic
960271472 3:115679171-115679193 ACAATCTAAGAGGGTGCAACAGG + Intronic
962337746 3:134551639-134551661 TCATTCTAATAGGATAAATCAGG - Intronic
963787553 3:149550208-149550230 ACAATCTTTAAGAGAAAATCTGG + Intronic
964332272 3:155616915-155616937 AATATCTAACAGGGTTAATCAGG - Intronic
964650129 3:159001909-159001931 TCAATCTAGAAGTGGAAATCAGG - Intronic
965328238 3:167334850-167334872 ACTATCCAAAGGGGTACATCAGG + Intronic
969680529 4:8640831-8640853 ACAAACTAAGAGGGGAAATACGG - Intergenic
973848311 4:54935424-54935446 ACAATCCAAATGAATAAATCAGG - Intergenic
975961859 4:79918550-79918572 ACACTCTAAAATAGTAAATGGGG + Intronic
976876434 4:89858710-89858732 AAATTGTAAAAGGGTAAAGCCGG + Intergenic
976960462 4:90965232-90965254 AAAATCTTAAATGGAAAATCTGG + Intronic
978083942 4:104626737-104626759 AGAATAGAAAAGAGTAAATCAGG + Intergenic
978441914 4:108742232-108742254 ACAATTTAATAGAATAAATCAGG + Exonic
978752641 4:112269269-112269291 AAAATCTAAAAAGGTAATACGGG + Exonic
978998429 4:115184969-115184991 ACAATTTAAAATGGTAACACTGG + Intergenic
980088630 4:128417987-128418009 AGGATGTAAAAGTGTAAATCTGG + Intergenic
980613585 4:135189804-135189826 AAAATCTGAATGGGTAAATATGG - Intergenic
983384737 4:167046058-167046080 AAAATTTAACAGGGTACATCAGG + Intronic
983676183 4:170296046-170296068 AAAATCTACAAGGGCCAATCTGG + Intergenic
987378510 5:17260870-17260892 ACAATATAAAAGGGTTAAGCAGG + Intronic
987931495 5:24405054-24405076 AGAATTTAAAAGGGTAGAACTGG - Intergenic
988691812 5:33580136-33580158 TCAACCTAAAAGGGTAAGGCAGG + Intronic
990511609 5:56494180-56494202 AGAATCTAAAACGCTAAATGAGG + Intergenic
992133596 5:73720181-73720203 ACAATCTAAAATGGCACAACTGG - Intronic
992385280 5:76278842-76278864 ACATTTTAAAAGGATAACTCTGG + Intronic
993179205 5:84528060-84528082 AAAATATAAAAGGGGAAATATGG - Intergenic
993778551 5:92034971-92034993 TCTATCTAAAAGGGTACATTAGG - Intergenic
994477992 5:100295235-100295257 ACATTCTTAAAGGCTAAATATGG + Intergenic
996265265 5:121532445-121532467 ACAGTCAAAATGGATAAATCAGG - Intergenic
996504936 5:124257981-124258003 ATAATCTAAAAGGAAAAATAAGG - Intergenic
998835254 5:146196988-146197010 ACATTCTAAAAAGGAAAATAAGG - Intergenic
999796624 5:154994807-154994829 ACAATCAAAAATGAAAAATCAGG - Intergenic
1006279360 6:33036383-33036405 AAAAGCTTAAAGGGAAAATCTGG - Intergenic
1006485368 6:34335971-34335993 ACAATATATAATGATAAATCTGG + Intronic
1007439840 6:41849223-41849245 ACATGATAAAAGGGTAAACCAGG + Intronic
1009195457 6:60679214-60679236 ACAAGCCCAAAGTGTAAATCTGG - Intergenic
1010349739 6:74859161-74859183 AAAATCTGAAAGTGTAAATTAGG + Intergenic
1010834907 6:80573943-80573965 ACACTTTAAAAGGGTGAATTGGG - Intergenic
1011285997 6:85723944-85723966 AATATCTAAAAGGGTTAATCAGG + Intergenic
1013340127 6:109205829-109205851 ACAATCTAAAACAGAAAGTCTGG - Intergenic
1013343309 6:109236435-109236457 ACATTCTACGAGGGGAAATCAGG - Intergenic
1013532955 6:111036770-111036792 ACAACTTAAAGAGGTAAATCTGG + Intergenic
1014456899 6:121646277-121646299 ACAATAAAAAATGGTAAATACGG + Intergenic
1014499844 6:122172782-122172804 ACAATCTAAAAACGAAAATAAGG + Intergenic
1015080219 6:129215268-129215290 ACAGTCTAAAAGACTAAATAAGG + Intronic
1015766173 6:136719330-136719352 ACTAATTAAAGGGGTAAATCTGG + Intronic
1017133046 6:151124231-151124253 ACAATATAAAAGGTAAAATAAGG - Intergenic
1017361928 6:153583493-153583515 ACAATTTTAAAGGGTGAGTCAGG + Intergenic
1020241681 7:6399971-6399993 ACAAACTGAAAGGGTGGATCAGG + Intronic
1021142633 7:17046351-17046373 AAACTTTAAAAGGGAAAATCTGG + Intergenic
1021658266 7:22893358-22893380 CTAATTTAAAAGGGTAAAACTGG - Intergenic
1025570664 7:62560306-62560328 ACAATCTATAAGGGGATATTTGG - Intergenic
1025797093 7:64748622-64748644 ACAATGTAAAAGGTAAAATTTGG - Intergenic
1025932000 7:66002898-66002920 ACAATTTAAAAAAGAAAATCAGG + Intergenic
1027733047 7:81900561-81900583 ACAATTAAAAAGGGCAAATAGGG - Intergenic
1029784924 7:102780391-102780413 ACCTTCTAAAGGAGTAAATCAGG - Intronic
1031283241 7:119832691-119832713 AAAATCTAATAGGGTTAGTCAGG + Intergenic
1031334344 7:120508853-120508875 CCAATCTAAAAGTGTGTATCTGG - Intronic
1031403561 7:121355265-121355287 ACAATCTAAAAGTGTGAAGTGGG - Intronic
1031406455 7:121393155-121393177 ACACTTTAAAATGGAAAATCTGG + Intronic
1031424008 7:121584151-121584173 AGAATATAAAAGGGTAAAGAAGG + Intergenic
1031468964 7:122146650-122146672 ACAATCCAACTGGGTAAATTAGG + Intergenic
1032601882 7:133306040-133306062 ACAAGGAAAAAGGGAAAATCAGG + Exonic
1035241082 7:157529716-157529738 ACCATTTAAAATGGTAAAACCGG + Intergenic
1038112804 8:24518107-24518129 TCCAGATAAAAGGGTAAATCTGG + Intronic
1038943434 8:32330925-32330947 ACAATCTAAAACTCTAGATCAGG - Intronic
1039183615 8:34892741-34892763 ACAATGGAAAAGGGAAAATAGGG + Intergenic
1039764200 8:40610919-40610941 AAAATGCAAAAGGGCAAATCTGG - Intronic
1040548495 8:48420481-48420503 ACAACCTAAAGGGGGAAATAGGG - Intergenic
1041326553 8:56672350-56672372 ACCATGTAAAATGGTAAACCTGG - Intergenic
1041352318 8:56960108-56960130 ACAATCTGACAGGTTAAAACAGG - Exonic
1044479740 8:92671418-92671440 ACACTATAAAATGGCAAATCTGG - Intergenic
1044718983 8:95127762-95127784 AAAATGTTAATGGGTAAATCTGG - Intergenic
1045043832 8:98254981-98255003 ATAATATAAAAGAGTAAATAAGG - Intronic
1045163030 8:99570532-99570554 ACTATTCAAAAGGGCAAATCAGG - Intronic
1045201575 8:99988414-99988436 TCAATCTGAAAGGCTAAATGGGG - Intronic
1053227794 9:36376219-36376241 AAAATCTAAAAATGTAAAGCGGG + Intronic
1053716707 9:40903500-40903522 ACAATCTACAAGAGTACATTTGG + Intergenic
1057065958 9:92051818-92051840 ACAATCTAAAAAGGAAATTAAGG + Intronic
1057588266 9:96348774-96348796 ACAATCTAAAAGGGTAAATCGGG - Intronic
1058682872 9:107455350-107455372 ACAATATGAAAAGGTAAATACGG + Intergenic
1059897234 9:118879981-118880003 ATTATCTAAAATGGTAAATCTGG + Intergenic
1060436607 9:123598391-123598413 CCAACCTCAAAGTGTAAATCAGG - Intronic
1186882488 X:13880373-13880395 ACCATTTAAAAAGGCAAATCAGG + Intronic
1189439715 X:41024430-41024452 ACAGTCTAAAAGGATGAATTTGG - Intergenic
1190935586 X:54996514-54996536 AAAGTCTTAAAGGGTAAACCTGG + Intronic
1191042530 X:56099614-56099636 ACAAACTAAAAGGATGACTCTGG + Intergenic
1191175741 X:57499619-57499641 ACAATCTCCAAGGTTAAAGCAGG + Intergenic
1192607358 X:72532392-72532414 AGAATCTAAAATGGTACAGCTGG - Intronic
1194603099 X:95948123-95948145 ACATTTTAAAAGGCTCAATCTGG - Intergenic
1195197040 X:102508746-102508768 AGAACCTAAAAGGACAAATCAGG - Intergenic
1196610281 X:117706780-117706802 ACATTCTAAAAGGATCACTCTGG + Intergenic
1198047778 X:132919858-132919880 GAAATCTTAAAGGGTAAATCAGG - Intronic
1199073163 X:143501980-143502002 ACACTCAAAAAGTGTAAGTCTGG + Intergenic
1201597621 Y:15689557-15689579 ACATTCTATAAGGGTAGAGCAGG + Intergenic
1202346074 Y:23928957-23928979 AAAATCTAAAAAGGTAAATAAGG + Intergenic
1202524697 Y:25741133-25741155 AAAATCTAAAAAGGTAAATAAGG - Intergenic