ID: 1057592062

View in Genome Browser
Species Human (GRCh38)
Location 9:96381342-96381364
Sequence GCCTTGGGAGGCCACCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057592062 Original CRISPR GCCTTGGGAGGCCACCGCCA GGG (reversed) Intronic
900136776 1:1121097-1121119 GCCTTGGCACGCCAGCCCCAGGG - Intergenic
900312861 1:2042881-2042903 GCCCTGGGAAGACACAGCCAAGG - Intergenic
901451276 1:9338256-9338278 TCCTGGGGAGCCCACGGCCAGGG - Intronic
901602566 1:10433282-10433304 GGGTTGGGAGGCCACCTCCACGG - Intronic
901782927 1:11606398-11606420 GGCTTCAGAGGCCACTGCCAAGG + Intergenic
901791090 1:11654110-11654132 GCCTTGAGAGGCGACTGGCAAGG - Intronic
902451334 1:16498842-16498864 GCCGTGGGAGGCCCTCGCGACGG - Intergenic
902501536 1:16914440-16914462 GCCGTGGGAGGCCCTCGCGACGG + Intronic
904064967 1:27742449-27742471 GCCATGGCAGGCCACCACGAGGG + Intronic
906697923 1:47837206-47837228 GCTCTGGGAGTCCACAGCCAGGG + Intronic
907823305 1:57991521-57991543 GCCATGGGAGGCCAGCCCAAAGG + Intronic
908727296 1:67190339-67190361 GTCTGGTGAGGCCACCGCAAAGG - Intronic
911739266 1:101369440-101369462 ACTTTGGGAGGCCAAGGCCAAGG - Intergenic
915469866 1:156119502-156119524 ACTTTGGGAGGCCAAGGCCAAGG - Intronic
920244049 1:204574841-204574863 GCCTTGGGAGGACAGCACAAGGG + Intergenic
921827517 1:219690106-219690128 TCCTTGGGATGTCACTGCCAGGG + Intronic
922719019 1:227890923-227890945 GGCTTGGGTGGCCACGGACAAGG - Intergenic
922767925 1:228165730-228165752 CCCTCCGGCGGCCACCGCCAGGG + Intergenic
923410894 1:233708027-233708049 GCCTTGGGAGACCAGGGCCAGGG + Intergenic
924048566 1:240057703-240057725 GCTTTGGGAGGTCAAGGCCAGGG + Intronic
1064196259 10:13246252-13246274 ACTTTGGGAGGCCAAGGCCAGGG + Intergenic
1064496021 10:15911388-15911410 GCCTTGGTAGGGCACAGTCATGG - Intergenic
1066527868 10:36300808-36300830 ACTTTGGGAGGCCATGGCCAGGG + Intergenic
1066746123 10:38605008-38605030 GCCTTGGCTGGCCACCCTCAGGG - Intergenic
1070020795 10:72583523-72583545 GCCTTGGGAGGCCAAGGCAGGGG - Intronic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1071686728 10:87765781-87765803 GCCTTGGGAGGCCAAGGCGGGGG + Intronic
1072692068 10:97578406-97578428 TCCTGGGGAGGACACCGCGAGGG + Intronic
1076298055 10:129402940-129402962 GCCCTGGGGGGCTTCCGCCAGGG + Intergenic
1076751094 10:132543660-132543682 ACTTTGGGAGGCCAAGGCCAGGG - Intronic
1076830802 10:132993248-132993270 GCCCTGTGAGGCCACGGCCATGG - Intergenic
1077477020 11:2795314-2795336 GTCTGGGGAGGCCACGGACAGGG + Intronic
1079027508 11:16960766-16960788 GCATTGGGAGGCCTCAGCCATGG - Intronic
1079170785 11:18093449-18093471 GCCTTGGAATGCAACCCCCAAGG + Intronic
1079782266 11:24622453-24622475 ACTTTGGGAAGCCACGGCCAAGG - Intronic
1083722197 11:64608941-64608963 GTCTTGGGAGGGGACGGCCACGG + Intronic
1084299802 11:68240851-68240873 GCTTTGGGAGGCCAAAGCAAAGG - Intergenic
1084349378 11:68584258-68584280 GCCATGGTGGGCCACCGCCACGG - Intronic
1084414462 11:69023255-69023277 ACTTTGGGAGGCCAAGGCCAAGG - Intergenic
1084426112 11:69085347-69085369 GCCCACTGAGGCCACCGCCAAGG - Intronic
1085286037 11:75361824-75361846 ACTTTGGGAGGCCAAGGCCAAGG + Intergenic
1089494319 11:118900725-118900747 GCCTGGAGAAGGCACCGCCATGG + Exonic
1089662223 11:119993091-119993113 GACCTGGGAGGCCAAGGCCAGGG - Intergenic
1091147300 11:133290848-133290870 GCCCTGTGAGGCCACAGCAATGG + Intronic
1095088285 12:38082255-38082277 GCTTTTGGAGGCCATCCCCAAGG - Intergenic
1095948448 12:47767140-47767162 GCCTCGGGTTGCCACAGCCAGGG + Intronic
1098535676 12:71591537-71591559 ACTTTGGGAGGCCAAGGCCAGGG - Intergenic
1099260559 12:80375616-80375638 TCCTTGGGAAGCCACCCACATGG + Intronic
1100458506 12:94775952-94775974 GCCATGGGAAGCCGCTGCCATGG - Intergenic
1102706000 12:114881013-114881035 TCCCTGGGAGGCCAACGCTAGGG + Intergenic
1102878832 12:116468502-116468524 ACTTTGGGAGGCCAAGGCCAAGG - Intergenic
1103623804 12:122204234-122204256 GCCTTGGGCGGCAGCCGCCTCGG - Intronic
1104625922 12:130354604-130354626 GCCCTGGGGGGACACTGCCAGGG + Exonic
1104962077 12:132493163-132493185 GCCCTGCGAGGCCACCCACACGG + Intronic
1105805846 13:23951191-23951213 GCCCTGGGAAGCCACTGCTATGG - Intergenic
1110242762 13:73287048-73287070 ACTTTGGGAGGCCAAGGCCAAGG - Intergenic
1110253161 13:73403178-73403200 ACTTTGGGAGGCCAAGGCCAAGG - Intergenic
1110784305 13:79505383-79505405 GCCTTGGGAGGCCAACACAGGGG + Intronic
1113900878 13:113797226-113797248 GCCCTGGGAGGCCCCGGCCAGGG - Intronic
1115807868 14:37072520-37072542 ACTTTGGGAGGCCAAGGCCAAGG + Intronic
1119385728 14:74257287-74257309 ACCCTGGGAGACCCCCGCCAAGG - Intronic
1120413850 14:84194288-84194310 GCCATGGGAGCCCAAAGCCATGG + Intergenic
1121584754 14:95055593-95055615 GTGATGGGAGGCCACCTCCACGG + Intergenic
1122155973 14:99750681-99750703 GTCTTAGGAGGCCACATCCATGG - Intronic
1122738485 14:103857140-103857162 GCCTTTTGGGGCCACCTCCATGG - Intergenic
1123818622 15:24004009-24004031 GGGTGGGGAGGCCACTGCCATGG + Intergenic
1124407042 15:29402552-29402574 ACTTTGGGAGGCCACAGCGAGGG - Intronic
1126650042 15:50910904-50910926 ACTTTGGGAGGCCAAGGCCAAGG - Intronic
1128069590 15:64786485-64786507 GCCATGGGAGGCCAAGGCGATGG + Intergenic
1128720154 15:69942079-69942101 GCCTGGGGAGCCCAGCGCCACGG - Intergenic
1129025993 15:72574824-72574846 GCTTTGGGAGGCCAAGGCCAAGG + Intronic
1129261833 15:74373074-74373096 CCCTTGGGAGGCCCCCGCTGCGG + Intergenic
1129300577 15:74623229-74623251 GGTTGGGGAGGCCACCTCCAGGG + Intronic
1132515125 16:362690-362712 GCCCAGGGAGGCCACTACCAAGG + Intergenic
1132663436 16:1071469-1071491 GCCTTGGGAAGCCACTGCTGTGG + Intergenic
1132709600 16:1260461-1260483 GCCCTGGGAGGCCAGGGCCCGGG + Intergenic
1136736937 16:32474633-32474655 GCCTTGGCTGGCCACCCTCAGGG + Intergenic
1137975168 16:53025117-53025139 ACTTTGGGAGGCCAAGGCCAAGG + Intergenic
1139493874 16:67302132-67302154 GCCACGGGAGGCCACACCCACGG - Intronic
1139794291 16:69469657-69469679 ACTTTGGGAGGCCAAGGCCAAGG - Intergenic
1139946148 16:70643617-70643639 ACCTTGGGAGGCCAAGGCCGGGG - Intronic
1141567074 16:84909923-84909945 GCCATGTGAGGACACGGCCAGGG - Intronic
1141657233 16:85422729-85422751 GACTTGGGAGGCCGGAGCCAGGG + Intergenic
1203016134 16_KI270728v1_random:354944-354966 GCCTTGGCTGGCCACCCTCAAGG - Intergenic
1203034469 16_KI270728v1_random:628102-628124 GCCTTGGCTGGCCACCCTCAAGG - Intergenic
1143170136 17:4924399-4924421 ACTTTGGGAGGCCAGGGCCAGGG - Intergenic
1145007281 17:19344807-19344829 GCCTGTGGAGACCACAGCCAGGG + Intronic
1145898978 17:28477600-28477622 CCCTTTGGAGGCCAGGGCCATGG - Intronic
1145939357 17:28734423-28734445 ACTTTGGGAGGCCAACGCCGAGG + Intronic
1147538238 17:41334788-41334810 ACCTTGGGAGGACATGGCCAGGG - Intergenic
1149405833 17:56350126-56350148 GCCTTGGTGGGCCCCAGCCAGGG + Intronic
1151265504 17:72952226-72952248 GCCCTGGGAGGCCAGTGCCTGGG - Intronic
1151369041 17:73635909-73635931 GCCTAGTGAGGACACAGCCAGGG + Intronic
1155156802 18:23164366-23164388 GCCCTGGGAGGACACCATCAGGG - Intronic
1157850481 18:51044467-51044489 GCCTTGGGAGGTCAAGGCCTTGG - Intronic
1158395826 18:57077814-57077836 GCCTTGGGACACCTCTGCCACGG - Intergenic
1160234824 18:77077645-77077667 CCCTTCTGAGGCCACCGCCCCGG - Intronic
1160801848 19:974044-974066 GCCCTGTTAGGCCACCGGCATGG + Exonic
1162315110 19:9934193-9934215 GGCTTGGTGGGCCAACGCCAAGG + Intronic
1163633683 19:18429081-18429103 GGCTTGGGCGGCCTCCGCCCTGG - Intronic
1163777676 19:19227597-19227619 ACATGGTGAGGCCACCGCCACGG + Exonic
1165462043 19:35949670-35949692 GCTTTGAGAGGCCACCCTCAGGG + Intergenic
1166785086 19:45362821-45362843 GCCTTTGGAGCCCACAGGCATGG + Intronic
1167591402 19:50406352-50406374 TCCTTGGAAGGCCACTGCCCAGG + Intronic
1168401035 19:56086563-56086585 GCCTTGGGAGGCCGCAGTGAGGG - Intergenic
925751432 2:7093507-7093529 GCCTTGGGAGGACAGTGTCATGG + Intergenic
927213322 2:20651688-20651710 GCCCCGGGAGGCCTCCACCAGGG - Intergenic
927712507 2:25334425-25334447 CTCTTGGGAGGCCACACCCAAGG - Intronic
928487269 2:31745312-31745334 GCCTTGGAAGACCATGGCCATGG + Intergenic
932626588 2:73301234-73301256 GCCTGGGGAGGTGACCCCCAGGG - Intergenic
934188079 2:89763754-89763776 GCCTTGGCTGGCCACCCTCAGGG + Intergenic
934308528 2:91844200-91844222 GCCTTGGCTGGCCACCCTCAGGG - Intergenic
935886922 2:107631028-107631050 TACTTGGGAGGCCACGGTCAGGG + Intergenic
936143951 2:109966641-109966663 AACTTGGGAGGCCACTGCAAAGG + Intergenic
936180633 2:110264602-110264624 AACTTGGGAGGCCACTGCAAAGG + Intergenic
936200736 2:110404828-110404850 AACTTGGGAGGCCACTGCAAAGG - Intronic
938728843 2:134130275-134130297 CACTCGGGAGCCCACCGCCAGGG - Intronic
942084223 2:172428689-172428711 GCGTTGGGCGGGCACAGCCAAGG + Intronic
942950789 2:181718718-181718740 GCTTTGGGAGGTCAATGCCAGGG - Intergenic
947844885 2:233236140-233236162 GGCATGAGAGGCCACCGCCAGGG + Intronic
947905691 2:233760286-233760308 GCCCTGGGACTCCACAGCCATGG - Exonic
949060668 2:241955257-241955279 GCCCTGGGAAGCCACCCCGAGGG - Intergenic
1170629681 20:18056594-18056616 GCCTCGGGAGCCCGACGCCAGGG + Intronic
1172503430 20:35443369-35443391 GCCTTGGGAAGCCACTGACATGG + Intronic
1174247583 20:49193426-49193448 TCTTTGGGAGGCCAATGCCAGGG + Intergenic
1174407396 20:50311113-50311135 GCCATGGGATGCCCTCGCCATGG + Intergenic
1175608191 20:60328569-60328591 GCCTTTGGAGCCCTCAGCCATGG - Intergenic
1175908415 20:62393084-62393106 GGCCTGGCAGGCCAGCGCCATGG + Intronic
1176015189 20:62927180-62927202 GCTTTGGGACCACACCGCCAAGG - Intronic
1176060119 20:63168865-63168887 GCCTCGGCAGGCCCCAGCCAGGG + Intergenic
1176069814 20:63220205-63220227 GCCTTGGGAGTGCACTGACATGG + Intergenic
1179972357 21:44843199-44843221 GCCCTGGGTAGCCACCTCCACGG + Intergenic
1180537184 22:16403781-16403803 GACCTGGGGGGCCACCGCAAAGG - Intergenic
1184149829 22:42631483-42631505 GCCCTGGGAGGCCTCTGCCCTGG - Intronic
1184438307 22:44493829-44493851 GCCTTGGGTGGGCACCACCCTGG - Exonic
1184687839 22:46104487-46104509 GCCTGGGGCAGCCACGGCCAAGG - Intronic
1184797905 22:46742375-46742397 GCCTTTGGAGGCCTCCCCCTGGG - Intergenic
1185266517 22:49906955-49906977 GCCTGGGGAGGGCACTGCCTGGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950034239 3:9873365-9873387 ACTTTGGGAGGCCAAGGCCAAGG + Intronic
950312308 3:11969286-11969308 ACTTTGGGAGGCCAAGGCCAAGG - Intergenic
952802817 3:37312959-37312981 ACTTTGGGAGGCCAGCGCGACGG + Intronic
953182158 3:40605880-40605902 GCCTTGAGAGCCAACAGCCAGGG + Intergenic
954435195 3:50492192-50492214 GCCTTAGAGGGCCACAGCCACGG - Intronic
954809802 3:53240916-53240938 GCCTTCTGAGGCCTCAGCCAGGG - Intronic
955022315 3:55133034-55133056 ACTTTGGGAGGCCAAGGCCAAGG + Intergenic
958039167 3:88206014-88206036 ACTTTGGGAGGCCAAGGCCATGG + Intergenic
961822226 3:129580917-129580939 TCCTTGGGAAGCCACCCCCAGGG + Intronic
965764505 3:172115690-172115712 ACCTTAGGATGCCACCGCCGAGG - Intronic
966761787 3:183425700-183425722 ACTTTGGGAGGCCAAGGCCAAGG + Intronic
967819838 3:193830676-193830698 TCCTTGGGTGGCCAGAGCCAGGG - Intergenic
968080933 3:195846613-195846635 TCCACTGGAGGCCACCGCCAAGG - Intergenic
968528185 4:1075395-1075417 GCCTTGGGAGGCTACAATCAGGG + Intronic
968580115 4:1385821-1385843 GACCTGGGAGGCTTCCGCCAGGG - Intronic
974896907 4:67950955-67950977 GCCTTGGTGGGCCAAGGCCAAGG + Intronic
980946255 4:139323301-139323323 CCTTTGGGAGGCCAAGGCCAAGG - Intronic
985009725 4:185570112-185570134 GCCTTGGGAAGCCCCCACCTGGG + Intergenic
985345817 4:189002661-189002683 CCCTTGAGAGCCCACCTCCAGGG - Intergenic
992167730 5:74071436-74071458 GCTTTGGGAGGCCAAGGCCGGGG - Intergenic
997349474 5:133220295-133220317 GCCTTAGGAGGCCTCCCCCAGGG - Intronic
1001596952 5:172904684-172904706 GCCTTGGCAGGCCCCTGCCATGG + Intronic
1002705453 5:181158379-181158401 ACTTTGGGAGGCCAAGGCCAAGG + Intergenic
1002820419 6:719469-719491 GCCATGGGAGGACACAGCAAGGG + Intergenic
1006420783 6:33932555-33932577 GTCTTGTGGGGCCACTGCCAGGG - Intergenic
1006641385 6:35491482-35491504 GACAAGGGAGGCCACTGCCAGGG + Intronic
1006778685 6:36616971-36616993 GCCTAGGGGGGCCATCTCCAGGG + Intergenic
1006944554 6:37776818-37776840 ACGTTTGGAGGCCACTGCCAAGG - Intergenic
1007563598 6:42830859-42830881 ACTTTGGGAGGCCAAGGCCAGGG - Intronic
1009419648 6:63450917-63450939 ACTTTGGGAGGCCAAGGCCAGGG - Intergenic
1009812628 6:68688709-68688731 GCCTTGGGAGTCCTCTGCAAGGG + Intronic
1013328341 6:109070523-109070545 GCATAGACAGGCCACCGCCAGGG + Intronic
1013730173 6:113155634-113155656 GCCTTGGGAGCCCAACGCCTTGG + Intergenic
1017905949 6:158757655-158757677 GCAAAGGGAGGCCTCCGCCAGGG - Intronic
1019700660 7:2473597-2473619 ACCTTGGGAGGCCATGGCAAGGG - Intergenic
1024997711 7:55286494-55286516 ACTTTGGGAGGCCAACACCATGG + Intergenic
1025185603 7:56855949-56855971 GCCCTGGGAGGCCATCGCTGGGG - Intergenic
1025976831 7:66376921-66376943 GCCTGGAGAGGCCACCACAAGGG + Intronic
1026246651 7:68626320-68626342 ACTTTGGGAGGCCAAGGCCAGGG + Intergenic
1026318724 7:69250515-69250537 ACTTTGGGAGGCCAACGCCAGGG + Intergenic
1028191250 7:87854916-87854938 ACTTTGGGAGGCCAAGGCCAGGG + Intronic
1029424794 7:100488768-100488790 GCCTTGAGACCCCATCGCCAGGG - Exonic
1029507946 7:100973808-100973830 GCTTTGGGAGGCCCCAGCCTGGG + Intronic
1029596476 7:101540095-101540117 GCCCTGGGAGGCCATGCCCAAGG - Intronic
1032828814 7:135600807-135600829 GCCTTGCAAGGCCACCACCTTGG + Intronic
1033340010 7:140484655-140484677 ACCTTGGGAGGCCAAGGCCTGGG - Intergenic
1035372796 7:158390198-158390220 GCCGTGGGAGGACACGGCCCAGG - Intronic
1035590052 8:805766-805788 GCTTTGGGAGGCCGAGGCCAAGG - Intergenic
1036243506 8:7097785-7097807 GCCTGGGGAGCCCACCTCCCAGG + Intergenic
1036257304 8:7216282-7216304 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1036309350 8:7674878-7674900 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1036360189 8:8071241-8071263 GCCTGGGGAGCCCACCTCCCAGG + Intergenic
1036829219 8:12009405-12009427 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1036890780 8:12595728-12595750 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1036898325 8:12653644-12653666 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1037553079 8:19993776-19993798 GCTTTGGGAGGCCAATGCAAGGG + Intergenic
1038451795 8:27644221-27644243 GCCTGGGAAGGCCAAGGCCAAGG - Intronic
1040913302 8:52542949-52542971 GGGTTAGGAGGCCACTGCCAAGG - Intronic
1042560792 8:70071098-70071120 GCCCTGGAAGACCACCGCCCCGG + Intronic
1049180847 8:141221417-141221439 GCCAGGGGTGGTCACCGCCAGGG + Intronic
1049463147 8:142739335-142739357 GCGTGGGGAGGCCACGGCCAGGG - Intergenic
1049745870 8:144263076-144263098 GCCTTGGGTGGCCAGCACCACGG + Exonic
1049806962 8:144545448-144545470 GCCCTTGGTGGCCACCTCCAGGG + Exonic
1052962856 9:34315782-34315804 ACTTTGGGAGGCCAAGGCCAGGG + Intronic
1056998116 9:91483111-91483133 GCCTTTGGAACCCACCACCAGGG - Intergenic
1057497132 9:95570234-95570256 GCCCTGGGTGGCCACTGCCACGG - Intergenic
1057592062 9:96381342-96381364 GCCTTGGGAGGCCACCGCCAGGG - Intronic
1057706714 9:97399928-97399950 GCCTTGAGAGGCCAGGGCCGGGG - Intergenic
1059411394 9:114134616-114134638 GCCTTGAGAGGCCAGTGCCTGGG - Intergenic
1062341067 9:136094269-136094291 GGCCTGGGAGGCCAACTCCAGGG + Intronic
1062410190 9:136419824-136419846 ACCTTGGGAGGCCAAGGCAACGG - Intronic
1062652804 9:137586991-137587013 GCCTTGGGCCGCCAGCCCCACGG + Exonic
1187459856 X:19477457-19477479 ACTTTGGGAGGCCAAGGCCAAGG + Intronic
1188107690 X:26163759-26163781 GCCTTGGGTGGCCATAGGCAGGG + Intergenic
1188111079 X:26196988-26197010 GCCTTGGGTGGCCATAGGCAGGG + Intergenic
1188347708 X:29087786-29087808 AACTTGGGAGGCCAAGGCCAAGG + Intronic
1188523238 X:31061365-31061387 GCCTTGGGAGCCCTCACCCAAGG + Intergenic
1188726799 X:33594582-33594604 ACTTTGGGAGGCCAAGGCCAAGG + Intergenic
1189369538 X:40416791-40416813 GTCATGGGAGGCCTCCCCCAGGG + Intergenic
1189850190 X:45169954-45169976 GCCTTGGGAGGCCGGCGCGGTGG + Intronic
1189994815 X:46628281-46628303 GGGGTGGGAGGCCACCCCCAGGG + Intronic
1190501913 X:51087668-51087690 GCCTTGGGAGCTCAGCTCCAAGG + Intergenic
1193509481 X:82382394-82382416 GCCTGGGCAGGCCAGCCCCAGGG + Intergenic
1196457607 X:115901234-115901256 GCCTAGCGAGGCCTCAGCCAAGG - Intergenic
1199947643 X:152681118-152681140 GCCCTGGGAGGCCACAGGCAGGG + Intergenic
1199962036 X:152787336-152787358 GCCCTGGGAGGCCACAGGCAGGG - Intergenic
1200182858 X:154161653-154161675 GCTTTGGGAGGCCAAGGCAAGGG + Intergenic
1200188512 X:154198767-154198789 GCTTTGGGAGGCCAAGGCAAGGG + Intergenic
1200194161 X:154235908-154235930 GCTTTGGGAGGCCAAGGCAAGGG + Intergenic
1200199917 X:154273711-154273733 GCTTTGGGAGGCCAAGGCAAGGG + Intronic