ID: 1057592341

View in Genome Browser
Species Human (GRCh38)
Location 9:96383500-96383522
Sequence GTTGACAAGCACGATGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 123}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057592325_1057592341 24 Left 1057592325 9:96383453-96383475 CCCCGGCCCCGGGCCCCGCCTCA 0: 1
1: 0
2: 7
3: 127
4: 1050
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592324_1057592341 25 Left 1057592324 9:96383452-96383474 CCCCCGGCCCCGGGCCCCGCCTC 0: 1
1: 2
2: 22
3: 176
4: 1418
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592335_1057592341 9 Left 1057592335 9:96383468-96383490 CCGCCTCACCCGTAGGTGGTCAG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592328_1057592341 18 Left 1057592328 9:96383459-96383481 CCCCGGGCCCCGCCTCACCCGTA 0: 1
1: 0
2: 4
3: 12
4: 171
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592333_1057592341 11 Left 1057592333 9:96383466-96383488 CCCCGCCTCACCCGTAGGTGGTC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592327_1057592341 22 Left 1057592327 9:96383455-96383477 CCGGCCCCGGGCCCCGCCTCACC 0: 1
1: 1
2: 22
3: 169
4: 1522
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592336_1057592341 6 Left 1057592336 9:96383471-96383493 CCTCACCCGTAGGTGGTCAGCAG 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592330_1057592341 16 Left 1057592330 9:96383461-96383483 CCGGGCCCCGCCTCACCCGTAGG 0: 1
1: 0
2: 1
3: 20
4: 231
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592326_1057592341 23 Left 1057592326 9:96383454-96383476 CCCGGCCCCGGGCCCCGCCTCAC 0: 1
1: 1
2: 7
3: 128
4: 1263
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592329_1057592341 17 Left 1057592329 9:96383460-96383482 CCCGGGCCCCGCCTCACCCGTAG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592337_1057592341 1 Left 1057592337 9:96383476-96383498 CCCGTAGGTGGTCAGCAGCGCCT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592323_1057592341 26 Left 1057592323 9:96383451-96383473 CCCCCCGGCCCCGGGCCCCGCCT 0: 1
1: 1
2: 13
3: 163
4: 1201
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592334_1057592341 10 Left 1057592334 9:96383467-96383489 CCCGCCTCACCCGTAGGTGGTCA 0: 1
1: 0
2: 1
3: 6
4: 65
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123
1057592338_1057592341 0 Left 1057592338 9:96383477-96383499 CCGTAGGTGGTCAGCAGCGCCTT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057592341 Original CRISPR GTTGACAAGCACGATGAGGA AGG Exonic
900768133 1:4519228-4519250 GATGACAAGCAAGATGCTGAGGG + Intergenic
901123460 1:6913112-6913134 GTTTACAAACATGAAGAGGAAGG - Intronic
909914789 1:81303467-81303489 GTTCACCAGAATGATGAGGAGGG - Intergenic
916106760 1:161438709-161438731 GTTTGCAAGCATGAGGAGGAAGG + Intergenic
916777599 1:167983827-167983849 TTTGACAAGCACCCTTAGGATGG + Intronic
919859352 1:201729016-201729038 GTTGACAATCAAGATGGGTAAGG + Intronic
920849655 1:209619962-209619984 GTTGACGAGCTCTATTAGGAAGG - Intronic
920949980 1:210563457-210563479 GGTGGAAAGCACGATGGGGAGGG + Intronic
923789375 1:237098973-237098995 GTGCACAAGTACAATGAGGAGGG + Intronic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1067547773 10:47207183-47207205 GTTGGCAGGCACAATGAGGGTGG - Intergenic
1070402937 10:76069237-76069259 TTTCACAAGCATGATGGGGAAGG + Intronic
1070617621 10:77981147-77981169 GATGACATTCAGGATGAGGACGG + Intronic
1071119667 10:82262786-82262808 TTTTACGAACACGATGAGGAGGG + Intronic
1071848364 10:89542875-89542897 GTTGAGAAGCATGATAATGAAGG - Intronic
1073982775 10:109173803-109173825 GATGACGAGGACAATGAGGAGGG - Intergenic
1074404488 10:113169308-113169330 GTTGAGAAACACGGTGAGGCTGG - Intergenic
1078448935 11:11426036-11426058 TTTGACAAGGAAGATGAGGAGGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080433886 11:32222348-32222370 GTTGACTAGCTCCAAGAGGAGGG + Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085527346 11:77172106-77172128 GTGGGCAAGCGCGAGGAGGAGGG - Intronic
1087260187 11:96002505-96002527 GATGACAATGACGATGATGATGG + Intronic
1093037738 12:14348908-14348930 GTTGACAAGAACTATAATGAGGG + Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1096964199 12:55612076-55612098 GATGACAGGCATGATGATGAAGG - Intergenic
1096989808 12:55791233-55791255 GGTGATAAGCACGGTGATGATGG + Intronic
1099976992 12:89556436-89556458 GTTGGCACGCAGGTTGAGGAAGG + Intergenic
1104539784 12:129653185-129653207 TTTGATAACCAGGATGAGGAGGG + Intronic
1107521006 13:41181382-41181404 GTTGACTAGGGAGATGAGGAGGG + Intergenic
1120558861 14:85964887-85964909 GTTGACAGGCACAATCAGCAAGG + Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1123435636 15:20252048-20252070 TTTGACAAGCACGCTGAGCATGG + Intergenic
1125390201 15:39184371-39184393 TTTGCCAAGCACAATGAAGAGGG + Intergenic
1128970812 15:72103874-72103896 GTTGACAAGGATGGTGAGGTTGG + Intronic
1130971466 15:88737021-88737043 GTTAACAAGAACCAGGAGGACGG + Intergenic
1131023084 15:89116274-89116296 GTTTACAAGCACAGTGAGGACGG - Intronic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1136288176 16:29256212-29256234 CTTGACAAGGACGGTGAGGACGG - Intergenic
1136848968 16:33598947-33598969 TTTGACAAGCACGCTGAGCATGG - Intergenic
1139595856 16:67957907-67957929 GCAGATAAGCACGATGAGGAGGG + Exonic
1141875425 16:86820805-86820827 GTTGGCAAGGATGATGAGTATGG - Intergenic
1142093850 16:88228979-88229001 CTTGACAAGGACGGTGAGGACGG - Intergenic
1203110675 16_KI270728v1_random:1447597-1447619 TTTGACAAGCACGCTGAGCATGG - Intergenic
1144956272 17:19020382-19020404 GTTGACACACATGAGGAGGATGG - Exonic
1145303522 17:21656773-21656795 CTAGACAAGGACAATGAGGAGGG + Intergenic
1145346521 17:22045076-22045098 CTAGACAAGGACAATGAGGAGGG - Intergenic
1150811734 17:68362229-68362251 GGTGAGAGGCAAGATGAGGAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1158448206 18:57539700-57539722 AGTGACAAGCCCGCTGAGGAGGG - Intergenic
1163739796 19:19004392-19004414 GAGGACGAGGACGATGAGGATGG - Exonic
1165031795 19:33002918-33002940 TTTGACGAGCACGCTGAGCATGG + Exonic
1167769986 19:51509013-51509035 GGGGACAAGCAGGATTAGGACGG - Intergenic
925615068 2:5737281-5737303 GTTGCAAAGCACAATGAGAAAGG - Intergenic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926431961 2:12796533-12796555 GGTGACCATCACGATGATGATGG + Intergenic
932128360 2:69165517-69165539 GGAGACAAGAAAGATGAGGAGGG + Intronic
933078908 2:77965010-77965032 GTTGACAAGCAAGCTGACAAGGG + Intergenic
939020076 2:136948038-136948060 GTTTACAAGGAAGATGAAGATGG - Intronic
941082451 2:161077811-161077833 GTTGACAAGGAAGATGACGGGGG + Intergenic
941690012 2:168491104-168491126 GTTGACAGTCACGCTGAGGATGG + Intronic
944096278 2:195972368-195972390 GTTGACATACTCGATGAGGAAGG + Exonic
946225684 2:218263008-218263030 GTTGGCAAGCAGGGAGAGGAAGG - Exonic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1169711829 20:8573182-8573204 GATGTCAAGCAAGATGAGAAAGG + Intronic
1170601371 20:17843858-17843880 GTTCACAAGCAAAATGAGGGAGG + Intergenic
1171130967 20:22652648-22652670 GCACACAAGCACGAGGAGGAAGG + Intergenic
1171416215 20:24982411-24982433 GTAGAAAAGCCTGATGAGGAAGG - Intronic
1171521044 20:25774458-25774480 CTAGACAAGGACAATGAGGAGGG + Exonic
1171555880 20:26082021-26082043 CTAGACAAGGACAATGAGGAGGG - Intergenic
1172602586 20:36194265-36194287 GGTGACAAGCGGGATGAGGATGG + Exonic
1173069424 20:39747384-39747406 GTTTACAAGCAGTATGAGGCTGG - Intergenic
1174338921 20:49883930-49883952 GGTGAAGAGCACGATGACGATGG - Exonic
1176654893 21:9579576-9579598 CTAGACAAGGACAATGAGGAGGG + Intergenic
1177820088 21:26021953-26021975 GATGACGAGGACGATGAGGATGG - Exonic
1180728833 22:17966129-17966151 GTTGTCAAGCAGGATGTGGCAGG - Intronic
1182676088 22:32041077-32041099 GATGACAAGCATGAGGAGTAAGG - Intergenic
954616568 3:51971704-51971726 GTTCAAAACCACGATGATGAGGG + Intronic
962270366 3:133973793-133973815 GCTGACAAAGATGATGAGGATGG + Exonic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962628155 3:137248255-137248277 GTGGACCAGCACAGTGAGGAAGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
969243165 4:5915226-5915248 GTTGACAGGCAAGATGAAGGGGG - Intronic
969829546 4:9783302-9783324 GTGGACAACGACGAGGAGGAGGG + Exonic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
971258188 4:25032108-25032130 ATTGACAAGATCCATGAGGACGG + Intergenic
979560909 4:122100992-122101014 GTTTACAAGCAAGATGAACAAGG + Intergenic
982731262 4:158957719-158957741 GTTGACAAGATAGGTGAGGACGG - Intronic
984529099 4:180894315-180894337 GGTGACCAGCCAGATGAGGAGGG - Intergenic
986333666 5:6736752-6736774 GTTTTCAAGCACCATGAGCAAGG - Intronic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
995298736 5:110553000-110553022 GTTGACAATAACAATGAGGAAGG - Intronic
998017613 5:138745079-138745101 GTTGACAAGGTAGATGGGGAGGG - Intronic
999081704 5:148850416-148850438 GTTGACCAGTAAGATGAGAATGG + Intergenic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003819063 6:9875646-9875668 TTTGACATGCACGTTTAGGAAGG - Intronic
1004171835 6:13301273-13301295 GCTCACAAGCACGCTGGGGAGGG + Intronic
1004999359 6:21225140-21225162 GTTGACACGCGCCATGAGGAGGG + Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1009517141 6:64634865-64634887 GATAACAAGCATGATGGGGATGG + Intronic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1010368376 6:75079079-75079101 GTTGACAGGCAAGCTGAGGTTGG + Intergenic
1020000486 7:4752918-4752940 GTTTACAAGTAAGATGAGAAGGG - Intronic
1024262141 7:47581235-47581257 GCTGACAAGCAGGAGGAGGGAGG - Intronic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025281518 7:57629406-57629428 CTAGACAAGGACAATGAGGAGGG + Intergenic
1025303212 7:57836109-57836131 CTAGACAAGGACAATGAGGAGGG - Intergenic
1028178448 7:87685688-87685710 GTTGACAAGCATCATGATGAAGG + Intronic
1028748166 7:94351267-94351289 GATCACAAGCAAGATGAGGTAGG + Intergenic
1034545713 7:151787376-151787398 GTTGCCAAGCACTAGGGGGAGGG - Intronic
1034558058 7:151862536-151862558 GTTGACAATGATGATGATGATGG - Intronic
1035357449 7:158285016-158285038 GATGACGAGCGTGATGAGGAGGG - Intronic
1038351410 8:26779534-26779556 CATGACAAGCAGGATGATGAAGG + Intronic
1038440121 8:27565669-27565691 GCTGACAGTCACGATGAGGAAGG + Intergenic
1043723876 8:83584114-83584136 GTTGTCATGTATGATGAGGAAGG - Intergenic
1045496902 8:102716811-102716833 GTTCAGAGGCACGATGAGGGAGG + Intergenic
1051586237 9:18729884-18729906 GTTCATAAGCACCATGAGAATGG + Intronic
1053559683 9:39177402-39177424 GTCGAGGAGCTCGATGAGGACGG + Exonic
1053577826 9:39370820-39370842 GTTGACAATCACCATGACAATGG - Intergenic
1053823790 9:41997652-41997674 GTCGAGGAGCTCGATGAGGACGG + Exonic
1053842335 9:42198763-42198785 GTTGACAATCACCATGACAATGG - Intergenic
1054099402 9:60929537-60929559 GTTGACAATCACCATGACAATGG - Intergenic
1054120799 9:61205161-61205183 GTTGACAATCACCATGACAATGG - Intergenic
1054137432 9:61441541-61441563 GTCGAGGAGCTCGATGAGGACGG - Intergenic
1054586948 9:66977394-66977416 GTTGACAATCACCATGACAATGG + Intergenic
1054606782 9:67189716-67189738 GTGGAGGAGCTCGATGAGGACGG - Intergenic
1057161743 9:92894138-92894160 GTTGACATGCAAGTTGATGATGG - Intergenic
1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG + Exonic
1057776124 9:98011285-98011307 GAAGACGAGGACGATGAGGATGG + Exonic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058384430 9:104417271-104417293 GGAGACAAGCATGATGAAGAGGG - Intergenic
1058829053 9:108799118-108799140 GTCACCAAGCACGATGAAGATGG - Intergenic
1060220495 9:121761761-121761783 GTTGACCAGCATGTTAAGGACGG - Intronic
1061222057 9:129258028-129258050 GTCGACAGGCACGTTGAGGCAGG + Intergenic
1203632618 Un_KI270750v1:83029-83051 CTAGACAAGGACAATGAGGAGGG + Intergenic
1185917890 X:4056510-4056532 GGGGCCAAGCAAGATGAGGATGG - Intergenic
1194983531 X:100465334-100465356 CTTGATAAGCACGATGCTGAAGG - Intergenic
1195850192 X:109274450-109274472 TCTGACAAGAACGATGAGGATGG - Intergenic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1199561506 X:149168564-149168586 GTTGAGAAGTCCGATGTGGATGG + Intergenic