ID: 1057595581

View in Genome Browser
Species Human (GRCh38)
Location 9:96413572-96413594
Sequence CAGTCTTAGTAGAGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057595570_1057595581 17 Left 1057595570 9:96413532-96413554 CCAGACCCCACCAGCCCCAGTGA No data
Right 1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG No data
1057595576_1057595581 2 Left 1057595576 9:96413547-96413569 CCCAGTGAAGAAGTAACTTCAAA No data
Right 1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG No data
1057595572_1057595581 11 Left 1057595572 9:96413538-96413560 CCCACCAGCCCCAGTGAAGAAGT No data
Right 1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG No data
1057595571_1057595581 12 Left 1057595571 9:96413537-96413559 CCCCACCAGCCCCAGTGAAGAAG No data
Right 1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG No data
1057595573_1057595581 10 Left 1057595573 9:96413539-96413561 CCACCAGCCCCAGTGAAGAAGTA No data
Right 1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG No data
1057595577_1057595581 1 Left 1057595577 9:96413548-96413570 CCAGTGAAGAAGTAACTTCAAAT No data
Right 1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG No data
1057595575_1057595581 3 Left 1057595575 9:96413546-96413568 CCCCAGTGAAGAAGTAACTTCAA No data
Right 1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG No data
1057595574_1057595581 7 Left 1057595574 9:96413542-96413564 CCAGCCCCAGTGAAGAAGTAACT No data
Right 1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057595581 Original CRISPR CAGTCTTAGTAGAGGGCACA GGG Intronic
No off target data available for this crispr