ID: 1057597134

View in Genome Browser
Species Human (GRCh38)
Location 9:96424087-96424109
Sequence ACCTTTCCACAGATGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057597134_1057597138 13 Left 1057597134 9:96424087-96424109 CCTCTCTCCATCTGTGGAAAGGT No data
Right 1057597138 9:96424123-96424145 ACGAGTCCCTGGTGCCAAAAAGG 0: 7
1: 559
2: 1295
3: 1388
4: 874
1057597134_1057597136 2 Left 1057597134 9:96424087-96424109 CCTCTCTCCATCTGTGGAAAGGT No data
Right 1057597136 9:96424112-96424134 TCTTCCACAAAACGAGTCCCTGG 0: 5
1: 294
2: 809
3: 1275
4: 1466
1057597134_1057597139 17 Left 1057597134 9:96424087-96424109 CCTCTCTCCATCTGTGGAAAGGT No data
Right 1057597139 9:96424127-96424149 GTCCCTGGTGCCAAAAAGGTTGG 0: 923
1: 1683
2: 1429
3: 952
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057597134 Original CRISPR ACCTTTCCACAGATGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr