ID: 1057599877

View in Genome Browser
Species Human (GRCh38)
Location 9:96449019-96449041
Sequence CCAGAGCCTGTATTTTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057599877_1057599880 -8 Left 1057599877 9:96449019-96449041 CCTGAACAAAATACAGGCTCTGG No data
Right 1057599880 9:96449034-96449056 GGCTCTGGAAAAATGTAAGAGGG No data
1057599877_1057599879 -9 Left 1057599877 9:96449019-96449041 CCTGAACAAAATACAGGCTCTGG No data
Right 1057599879 9:96449033-96449055 AGGCTCTGGAAAAATGTAAGAGG No data
1057599877_1057599883 13 Left 1057599877 9:96449019-96449041 CCTGAACAAAATACAGGCTCTGG No data
Right 1057599883 9:96449055-96449077 GGAAAGAACGGCTGTAGGATAGG No data
1057599877_1057599882 8 Left 1057599877 9:96449019-96449041 CCTGAACAAAATACAGGCTCTGG No data
Right 1057599882 9:96449050-96449072 AAGAGGGAAAGAACGGCTGTAGG No data
1057599877_1057599881 1 Left 1057599877 9:96449019-96449041 CCTGAACAAAATACAGGCTCTGG No data
Right 1057599881 9:96449043-96449065 AAAATGTAAGAGGGAAAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057599877 Original CRISPR CCAGAGCCTGTATTTTGTTC AGG (reversed) Intergenic
No off target data available for this crispr