ID: 1057600086

View in Genome Browser
Species Human (GRCh38)
Location 9:96450251-96450273
Sequence GCGACCACTGCGGGCCCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057600086_1057600099 21 Left 1057600086 9:96450251-96450273 CCTCCCGGGCCCGCAGTGGTCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1057600099 9:96450295-96450317 GGGAGTCCCGTGGCTGCCGCTGG 0: 1
1: 0
2: 1
3: 20
4: 158
1057600086_1057600098 11 Left 1057600086 9:96450251-96450273 CCTCCCGGGCCCGCAGTGGTCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1057600098 9:96450285-96450307 GGGCGCTCTGGGGAGTCCCGTGG 0: 2
1: 0
2: 2
3: 17
4: 232
1057600086_1057600096 0 Left 1057600086 9:96450251-96450273 CCTCCCGGGCCCGCAGTGGTCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1057600096 9:96450274-96450296 GGCGGCATGAAGGGCGCTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1057600086_1057600097 1 Left 1057600086 9:96450251-96450273 CCTCCCGGGCCCGCAGTGGTCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1057600097 9:96450275-96450297 GCGGCATGAAGGGCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 88
1057600086_1057600093 -10 Left 1057600086 9:96450251-96450273 CCTCCCGGGCCCGCAGTGGTCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1057600093 9:96450264-96450286 CAGTGGTCGCGGCGGCATGAAGG 0: 1
1: 0
2: 0
3: 0
4: 50
1057600086_1057600094 -9 Left 1057600086 9:96450251-96450273 CCTCCCGGGCCCGCAGTGGTCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1057600094 9:96450265-96450287 AGTGGTCGCGGCGGCATGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 35
1057600086_1057600095 -1 Left 1057600086 9:96450251-96450273 CCTCCCGGGCCCGCAGTGGTCGC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1057600095 9:96450273-96450295 CGGCGGCATGAAGGGCGCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057600086 Original CRISPR GCGACCACTGCGGGCCCGGG AGG (reversed) Exonic