ID: 1057601891

View in Genome Browser
Species Human (GRCh38)
Location 9:96465385-96465407
Sequence TGCCGCGCATACCCCCTCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057601891_1057601895 -10 Left 1057601891 9:96465385-96465407 CCCGAGAGGGGGTATGCGCGGCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1057601895 9:96465398-96465420 ATGCGCGGCAGAGGCAGAGGTGG 0: 1
1: 0
2: 2
3: 30
4: 362
1057601891_1057601896 -4 Left 1057601891 9:96465385-96465407 CCCGAGAGGGGGTATGCGCGGCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1057601896 9:96465404-96465426 GGCAGAGGCAGAGGTGGCCCTGG 0: 1
1: 1
2: 5
3: 145
4: 1019
1057601891_1057601897 -3 Left 1057601891 9:96465385-96465407 CCCGAGAGGGGGTATGCGCGGCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1057601897 9:96465405-96465427 GCAGAGGCAGAGGTGGCCCTGGG 0: 1
1: 1
2: 6
3: 83
4: 715
1057601891_1057601900 29 Left 1057601891 9:96465385-96465407 CCCGAGAGGGGGTATGCGCGGCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1057601900 9:96465437-96465459 TTTGACGCTTTTGACCAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057601891 Original CRISPR TGCCGCGCATACCCCCTCTC GGG (reversed) Exonic