ID: 1057602508

View in Genome Browser
Species Human (GRCh38)
Location 9:96471059-96471081
Sequence GTCCCAGGGCACCCCGGAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057602498_1057602508 15 Left 1057602498 9:96471021-96471043 CCAACTGCACCGATGGAGGAACC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1057602508 9:96471059-96471081 GTCCCAGGGCACCCCGGAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 173
1057602500_1057602508 6 Left 1057602500 9:96471030-96471052 CCGATGGAGGAACCCACAGTGGT 0: 1
1: 0
2: 2
3: 13
4: 115
Right 1057602508 9:96471059-96471081 GTCCCAGGGCACCCCGGAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 173
1057602503_1057602508 -6 Left 1057602503 9:96471042-96471064 CCCACAGTGGTGGAGGAGTCCCA 0: 1
1: 0
2: 0
3: 15
4: 122
Right 1057602508 9:96471059-96471081 GTCCCAGGGCACCCCGGAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 173
1057602504_1057602508 -7 Left 1057602504 9:96471043-96471065 CCACAGTGGTGGAGGAGTCCCAG 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1057602508 9:96471059-96471081 GTCCCAGGGCACCCCGGAAGAGG 0: 1
1: 0
2: 3
3: 22
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057602508 Original CRISPR GTCCCAGGGCACCCCGGAAG AGG Exonic
900361288 1:2290217-2290239 GTCCCGGGGCTCCTGGGAAGAGG + Intronic
900486715 1:2926140-2926162 CTCCCAGGGGACTCCGGAGGTGG + Intergenic
900559150 1:3295103-3295125 CTCCCAGGGCACCCAGGTTGTGG + Intronic
901665397 1:10823313-10823335 GTCCCTGGGGACTCCGGAAAAGG - Intergenic
902435136 1:16393518-16393540 GTCCCAGTCCACCCGGGAAGAGG + Intronic
903323348 1:22555573-22555595 GTGACAGGGCTCCCAGGAAGCGG - Intergenic
903828582 1:26161705-26161727 GCCCCAGGATGCCCCGGAAGCGG + Exonic
904701648 1:32361755-32361777 GTCCCAGGACAGCCCGGAGGCGG - Exonic
905379896 1:37554313-37554335 GAGCCTGGGCACCCCGGAAGCGG - Intergenic
911683859 1:100750253-100750275 GCCCCATGGCACCCGGGAGGAGG + Intergenic
912174300 1:107139106-107139128 GGCCCTGGGCAGCCAGGAAGTGG - Intergenic
912687762 1:111780299-111780321 TTACTAGGGCACCCCAGAAGAGG - Exonic
912763270 1:112386914-112386936 GTCCATGGGCAGCCCGGAAAAGG - Intergenic
915288266 1:154866690-154866712 GCCCCAAGGCACACAGGAAGTGG + Intronic
917796673 1:178537895-178537917 GTCCCAGGCCACACCTGAAAAGG - Intronic
920174109 1:204089530-204089552 GTGTGAGGGGACCCCGGAAGAGG + Intronic
924531899 1:244900556-244900578 GACACAGGGCCCCCAGGAAGTGG - Intergenic
1062989068 10:1798821-1798843 GTGCCAGGGCACTCAGGATGTGG + Intergenic
1063086581 10:2823602-2823624 CTCCCAGAGGACCCCGGAAGTGG + Intergenic
1065637554 10:27746029-27746051 GGCCCGGGGCTCCCCGGCAGCGG - Exonic
1067811146 10:49428493-49428515 GTCCCAGGTCACCCAGCAAGGGG + Intergenic
1069680126 10:70278229-70278251 GTCCCAGGGTATCCAGCAAGAGG + Intronic
1071266471 10:83969031-83969053 TTCCCAGTGCACCATGGAAGAGG + Intergenic
1072451763 10:95544398-95544420 GTCCCTGGGCTCCTCAGAAGGGG - Intronic
1073124094 10:101139297-101139319 ATCCCAGGGGACCCCAGATGAGG - Intergenic
1073485923 10:103819266-103819288 TTCCCAGGGAACCCCAGGAGAGG + Intronic
1076116786 10:127906854-127906876 GGACCAGGCCTCCCCGGAAGGGG + Intergenic
1076360017 10:129881599-129881621 GTCCCTGTGCACCGCGAAAGAGG - Intronic
1076374514 10:129973969-129973991 GTCCCAGGTTCTCCCGGAAGAGG - Intergenic
1076590403 10:131578442-131578464 GGCCCAGGCCGCCCCAGAAGCGG - Intergenic
1077462049 11:2715580-2715602 GTCCCAGGGGACCCCAGCAGGGG - Intronic
1079355925 11:19730363-19730385 GGCCAAGGGCACCCTGGAGGGGG + Intronic
1081423786 11:42902908-42902930 TTCCTAGGGCACCCCAGAAGGGG - Intergenic
1083184100 11:61007644-61007666 GTCCCAGAGCGCCCCGCACGCGG - Exonic
1083246237 11:61430019-61430041 GTCCCTGCGCATGCCGGAAGTGG - Intronic
1083540578 11:63509131-63509153 GGCCCAGGGCAGCCTGGAACCGG - Intronic
1083628746 11:64085248-64085270 GTCCCTGGGCACCACGGAGGTGG + Intronic
1084009718 11:66340741-66340763 GAGCCTGGGCACCCCGGAACTGG - Intronic
1084715355 11:70870125-70870147 GGCCCAGGGCACTATGGAAGAGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089763481 11:120746023-120746045 GTCCCATTTCACCCAGGAAGAGG - Intronic
1091563256 12:1630149-1630171 GTCCCCAGGCTCCCCGGGAGGGG - Intronic
1096672088 12:53206066-53206088 GTCCCAGGGCCCCCTTTAAGGGG - Intronic
1096706378 12:53424846-53424868 GTCCCAGGGCTCCCTGGAGGAGG - Exonic
1096994354 12:55829634-55829656 TTCCCTGGTGACCCCGGAAGTGG - Exonic
1103601386 12:122056876-122056898 CTCCCAGGGTCCCCCAGAAGGGG + Intronic
1104064118 12:125292695-125292717 GTCACAGGTCACTCCTGAAGGGG - Intronic
1106467399 13:30025102-30025124 GACCCAGGGCCCCCAGGCAGTGG + Intergenic
1109811661 13:67520558-67520580 GCCCCAGGGTGCCCAGGAAGAGG + Intergenic
1118259360 14:64233181-64233203 GTCCGAGTGCAGCCCGGCAGAGG - Exonic
1118760102 14:68875697-68875719 TTCCCAGGGCACTCTGGCAGAGG - Intronic
1120230034 14:81832029-81832051 GCCCAAGGGCACCCAGTAAGTGG + Intergenic
1120845614 14:89122476-89122498 GTCCCTGGGAAGCCGGGAAGAGG + Intergenic
1121023009 14:90593257-90593279 GTGCCAGGGCACCGAGGCAGGGG + Intronic
1122489060 14:102101326-102101348 GTCACAGTGAACCACGGAAGGGG - Intronic
1122804126 14:104248098-104248120 GGCCCAGGGCACCTCTGGAGAGG + Intergenic
1123682523 15:22772972-22772994 CTCCCAGGGGACCCGGTAAGTGG + Intergenic
1125603851 15:40929207-40929229 GTCCCAGCGCCGCCCGGAGGGGG - Intergenic
1125882956 15:43209388-43209410 GACCCAGGCCACCCAGGAAGGGG - Exonic
1127912779 15:63431895-63431917 GCCCCAGGTCACCCAGAAAGTGG + Intergenic
1128365101 15:66994119-66994141 CTCCCAAGGCACCCCTGAACTGG + Intergenic
1129862387 15:78872774-78872796 GCCCCAGGGCACGCCGGGACTGG - Intronic
1132728588 16:1349596-1349618 GTCCGAGGGCAGCCTGGGAGAGG + Exonic
1136026352 16:27471392-27471414 GTCTCAGGGCTACGCGGAAGAGG + Intronic
1139952995 16:70680934-70680956 GGCCCAGGGCACCCCAGCAGGGG - Intronic
1139955759 16:70692294-70692316 CTCCCACCCCACCCCGGAAGTGG + Intronic
1141687181 16:85577159-85577181 GTCCCTGGGCACCCGGCCAGGGG + Intergenic
1142582675 17:951871-951893 GACGGAGGGCACCCGGGAAGGGG + Intronic
1144608880 17:16690806-16690828 GCCCCACGGCACCCGGGATGGGG + Intronic
1144824381 17:18097676-18097698 ATCCCAGGACACCCCGGCAGAGG + Intronic
1144903940 17:18625014-18625036 GCCCCATGGCACCCGGGATGGGG - Intergenic
1145128644 17:20321728-20321750 GCCCCACGGCACCCGGGATGGGG + Intergenic
1145195979 17:20895587-20895609 GCCCCACGGCACCCGGGATGGGG - Intronic
1147327029 17:39674557-39674579 GTCCCAGAGGAGCCCAGAAGTGG - Intronic
1148732311 17:49844965-49844987 GTCCAAGGTCACACGGGAAGAGG + Intronic
1149035941 17:52134791-52134813 GTGCCAGGGCACAGTGGAAGAGG - Intronic
1151655401 17:75493507-75493529 GTCCCATGGCACCGCTGATGTGG + Exonic
1152242486 17:79167766-79167788 GGTCCAGGGCACCCCGGAGCCGG + Intronic
1152809951 17:82376596-82376618 TCCCCAGGGCCTCCCGGAAGAGG + Intergenic
1156449594 18:37259403-37259425 ATCCAAGGGCGCCCCAGAAGAGG + Intronic
1160786709 19:903477-903499 GCCACCGGGCACCCGGGAAGCGG + Intronic
1160797625 19:953169-953191 GTCCCAGGGCCACCTGGGAGTGG - Intronic
1161042070 19:2115589-2115611 GTACCAGGACACCCCGGGCGTGG - Exonic
1161516578 19:4699894-4699916 CTCCCAGGCCACCTCGGGAGTGG - Intronic
1161772080 19:6236389-6236411 GAGCCAGCGCACCCCGGCAGAGG + Intronic
1161827441 19:6577862-6577884 GACCCAGGGCATTCTGGAAGAGG - Intergenic
1161968268 19:7561117-7561139 GGCCCAGGGGACCCCCCAAGAGG + Intronic
1162147497 19:8621632-8621654 GACCCAGGCCACCCCAGAAAAGG - Intergenic
1162479480 19:10920319-10920341 GTCCCAGGGGTCCCTGGCAGAGG + Intronic
1163471123 19:17497521-17497543 ATCCCAGGGGCCCCAGGAAGAGG - Intronic
1163610981 19:18301408-18301430 GTCCCAGGGCACCCAGGCAGTGG - Intergenic
1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG + Intronic
1167688027 19:50968735-50968757 CTCCCAGGCCTCCCTGGAAGAGG + Exonic
925160684 2:1681469-1681491 GCCCCAGGGCACCCCCGAGATGG + Intronic
926320149 2:11743783-11743805 CTCGCAGGGCACCCGTGAAGAGG + Intronic
927509263 2:23634308-23634330 GCCCATGTGCACCCCGGAAGTGG + Intronic
928016303 2:27661080-27661102 GACCCAGGGCACGAGGGAAGAGG + Exonic
928319040 2:30268666-30268688 GTCCCAGGGCAAACCGGTACAGG + Intronic
930753766 2:54955834-54955856 GTCCGTGGTCAACCCGGAAGAGG - Intronic
935419150 2:102848689-102848711 GTCCCAGTGGACCCAGGGAGCGG - Intergenic
941733653 2:168948059-168948081 ATCCCAGGGCACACAGGATGTGG + Intronic
942351558 2:175058180-175058202 ATCCCAGGGCACAGGGGAAGTGG - Intergenic
948373621 2:237505850-237505872 GTCCCAGGGCCCTCTGGAGGTGG + Intronic
948653318 2:239462451-239462473 GGCCCAGGGAACTCCGGAACCGG + Intergenic
948697913 2:239742635-239742657 GTCCCAAGGCTCCCTGGCAGGGG - Intergenic
948698587 2:239746857-239746879 GTTCCAGTGCACCCCTGAACCGG + Intergenic
948726676 2:239938521-239938543 CTCCCAGGGCATCCTGGAAGAGG - Intronic
1169193053 20:3669796-3669818 ATCCCAAGGCTCCCCTGAAGAGG - Intronic
1170704058 20:18728770-18728792 GACCCAGGGGACCCAGGCAGGGG - Intronic
1173306830 20:41858489-41858511 GTCCCAGGGAAGCAGGGAAGGGG + Intergenic
1174058665 20:47817079-47817101 TTCCCTGGGCACCCAGGAAAGGG + Intergenic
1174102557 20:48138521-48138543 GTCCAAAGGATCCCCGGAAGGGG - Intergenic
1176002556 20:62839576-62839598 GCTCCAGGGCACCCAGGCAGAGG - Intronic
1176002582 20:62839678-62839700 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176002600 20:62839726-62839748 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176002618 20:62839774-62839796 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176299858 21:5094521-5094543 GCCCCAGGGCACCCTGGAAGCGG - Intergenic
1179856518 21:44165073-44165095 GGCCCAGTGCTCCCCGGAACTGG - Intergenic
1179857164 21:44167390-44167412 GCCCCAGGGCACCCTGGAAGCGG + Intergenic
1180014514 21:45073947-45073969 GTCCCAGGCAACTCCGGGAGAGG + Intronic
1180876574 22:19177816-19177838 GTCCCTGGGCATCCCGCATGTGG + Exonic
1181010057 22:20035020-20035042 CTTCCAGGGCACCCGGCAAGGGG + Intronic
1181038186 22:20179798-20179820 GTCCCAGGGCAGCTGGGCAGAGG - Intergenic
1182105019 22:27682875-27682897 GGCCAAGGGCACCCAGGACGTGG + Intergenic
1185171124 22:49295234-49295256 GTTCCAGGGCCCCCCGGAGCTGG - Intergenic
949862134 3:8515592-8515614 GTTCCAGGGCACACCCAAAGGGG - Intronic
950591775 3:13941141-13941163 ATGCCAGGGCCACCCGGAAGTGG + Intronic
950842718 3:15983121-15983143 GGCCCAGGGCACCCTGGAAATGG - Intergenic
951325850 3:21301211-21301233 TTCCCAGGTCACCAGGGAAGTGG - Intergenic
952884322 3:38003263-38003285 CTCCCAGGGCCTCCCAGAAGTGG - Exonic
953459786 3:43073095-43073117 GTCCCAGGGAATCCCAGAGGTGG + Intergenic
954624882 3:52016897-52016919 GTCCCAGAGCACCCAGGGAGGGG - Intergenic
955916267 3:63911918-63911940 GCCCCAGGGCAGCGCGGGAGAGG - Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
968225187 3:196968747-196968769 GTCCCAGGAGGCCCCGGAGGCGG + Exonic
968448457 4:663996-664018 GGCCCCGCGCACCCCGGATGGGG + Intronic
968655585 4:1777188-1777210 GGCCCAGGGCACCAAGGAATGGG + Intergenic
968671854 4:1856241-1856263 GTCCCGGTGCACGCCGGAACCGG - Exonic
968916184 4:3497951-3497973 GTCCCAGGGCACCCCTGTCTGGG - Intronic
969351480 4:6600482-6600504 CTCCCAGGGGAGCCAGGAAGGGG - Intronic
969632172 4:8345192-8345214 CTCCCAGGGCAGCCCGGCCGTGG + Intergenic
985474628 5:72728-72750 GTCCCAGGGCCTCCGGGGAGTGG - Intergenic
985474689 5:72924-72946 GTCCCAGGGCCTCCGGGGAGAGG - Intergenic
985474705 5:72973-72995 GTCCCAGGGCCTCCGGGGAGAGG - Intergenic
985474762 5:73169-73191 GTCCCAGGGCCTCCGGGGAGAGG - Intergenic
985474793 5:73267-73289 GTCCCAGGGCCTCCGGGGAGTGG - Intergenic
985474839 5:73414-73436 GTCCCAGGGCCTCCGGGGAGAGG - Intergenic
985474870 5:73512-73534 GTCCCAGGGCCTCCGGGGAGAGG - Intergenic
986626829 5:9730538-9730560 GTCCCAGAGCACCCAGGCACAGG + Intergenic
988716435 5:33833399-33833421 GTCCCTGAGCTCCCCTGAAGAGG - Intronic
1000825392 5:166038162-166038184 TTACCAGTGCACCCAGGAAGTGG - Intergenic
1001704048 5:173729059-173729081 CGCCCAGGGCACCCCGGAGTAGG - Intergenic
1001722352 5:173867094-173867116 GCCACAGGGTACCGCGGAAGTGG - Intergenic
1001847711 5:174936550-174936572 GTCCCTGTGCACCCCTGAAATGG + Intergenic
1002043831 5:176531373-176531395 GGCCCAGGGCAGCCCTGAACTGG - Intronic
1003330299 6:5123634-5123656 GAGCCAGGGCACCCCAGGAGAGG - Intronic
1003745854 6:9001253-9001275 GTCCCAGGCAGCCCTGGAAGAGG - Intergenic
1003965191 6:11246261-11246283 GGCACAGGGCAGCCGGGAAGAGG + Intronic
1006677740 6:35776519-35776541 GCCCCAGGCCACCCCGGCGGAGG - Intergenic
1006924037 6:37644421-37644443 GGCCCAGGGCACCCCAGACTGGG - Intronic
1015912077 6:138179064-138179086 GTCCTTGGCCACCCTGGAAGAGG + Intronic
1020098142 7:5379843-5379865 TTCCCAGGGCTTCCGGGAAGAGG + Intronic
1022514903 7:30969281-30969303 GCCCGAGGTCACCCCAGAAGAGG - Intronic
1023015926 7:35968671-35968693 GGACCAGGGCACGCAGGAAGGGG - Intergenic
1024030041 7:45453358-45453380 GGCCTAGGGCTCCCCAGAAGGGG + Intergenic
1026219702 7:68383004-68383026 GTTCCAGGGCAGCTGGGAAGAGG - Intergenic
1027046044 7:74991976-74991998 GTCTCAGGAGACCCAGGAAGAGG + Intronic
1028861993 7:95662799-95662821 GTCCCAGGGCATGCCGAAATGGG + Intergenic
1029386778 7:100248595-100248617 GTCTCAGGAGACCCAGGAAGAGG - Intronic
1032441380 7:131945402-131945424 TCCTCAGAGCACCCCGGAAGCGG + Intergenic
1032839690 7:135704146-135704168 GTCCCAGGTGACCCAGGAAAAGG - Intronic
1033146690 7:138877080-138877102 GTCCCATGGCAACATGGAAGAGG + Intronic
1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG + Intronic
1036825415 8:11971990-11972012 GTCCCAGGGCACCCATGAGGAGG - Intergenic
1037751187 8:21683426-21683448 GTCCCAGGGCAGCCTTGGAGAGG - Intergenic
1039115854 8:34090571-34090593 ATGCCAGGGCAACCCGGAAGTGG - Intergenic
1048365210 8:133732576-133732598 GTCCCAGGTCACAGAGGAAGAGG + Intergenic
1049299465 8:141862011-141862033 GTGCCAGGGCACCCCGGAGAAGG - Intergenic
1049369509 8:142257175-142257197 GTCCAAGGTCACCCCCGAAGTGG - Intronic
1049441481 8:142611751-142611773 GTCCCAGGACAGCCCAGAGGGGG - Exonic
1049587012 8:143436923-143436945 GTCCCAGGGCCCCAGGGTAGAGG + Intergenic
1049835975 8:144735797-144735819 GTCCCATGGTACCCCGGCAGTGG - Intronic
1052036881 9:23692813-23692835 ATCCCTGGGCACCCTGGAACAGG - Exonic
1057293050 9:93819265-93819287 GGCCCAGCGCCACCCGGAAGGGG - Intergenic
1057440543 9:95079867-95079889 AGCCCAGGACACCCCTGAAGTGG - Intronic
1057602508 9:96471059-96471081 GTCCCAGGGCACCCCGGAAGAGG + Exonic
1059757925 9:117311040-117311062 GTCCCAGGGAGCCCCAGTAGGGG - Intronic
1060036631 9:120261520-120261542 CTCCCAGGGCTCCCCTGGAGAGG + Intergenic
1062119115 9:134824593-134824615 CCCCCAGGGCCCCCCGGGAGAGG + Exonic
1062490828 9:136804146-136804168 GCCCAAGGGCACGCTGGAAGAGG + Intronic
1203770091 EBV:45492-45514 GTCCCAGGGGACGTCGGCAGGGG - Intergenic
1203774356 EBV:64525-64547 GTCTCAGGGCAGCCCTGCAGCGG + Intergenic
1188838145 X:34984121-34984143 ATGCCAGGGCAACCTGGAAGTGG + Intergenic
1189608348 X:42704160-42704182 TTCCCATGGTACCCCGGCAGTGG - Intergenic
1196493198 X:116292344-116292366 ATGCCAGGGCAACCCGGAAGTGG - Intergenic
1197923346 X:131619791-131619813 GTCAAAGGGAACCCAGGAAGAGG + Intergenic
1198205416 X:134460440-134460462 GGCCCAGGGAACCCCGCAGGCGG + Intronic
1198205455 X:134460543-134460565 TTCCCAGGGCTCCCCCGAGGAGG - Intronic
1198398891 X:136251123-136251145 ATCCCAGGGCACTCCGGCGGGGG + Intronic