ID: 1057605891

View in Genome Browser
Species Human (GRCh38)
Location 9:96497334-96497356
Sequence TCGGGGGTCCCTGGCCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 271}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057605891_1057605897 -10 Left 1057605891 9:96497334-96497356 CCACACAGGCCAGGGACCCCCGA 0: 1
1: 0
2: 2
3: 29
4: 271
Right 1057605897 9:96497347-96497369 GGACCCCCGAGGCGCTGGGGAGG No data
1057605891_1057605902 -3 Left 1057605891 9:96497334-96497356 CCACACAGGCCAGGGACCCCCGA 0: 1
1: 0
2: 2
3: 29
4: 271
Right 1057605902 9:96497354-96497376 CGAGGCGCTGGGGAGGAATCCGG No data
1057605891_1057605905 13 Left 1057605891 9:96497334-96497356 CCACACAGGCCAGGGACCCCCGA 0: 1
1: 0
2: 2
3: 29
4: 271
Right 1057605905 9:96497370-96497392 AATCCGGAAGGCTTTGCTCAGGG No data
1057605891_1057605903 1 Left 1057605891 9:96497334-96497356 CCACACAGGCCAGGGACCCCCGA 0: 1
1: 0
2: 2
3: 29
4: 271
Right 1057605903 9:96497358-96497380 GCGCTGGGGAGGAATCCGGAAGG No data
1057605891_1057605904 12 Left 1057605891 9:96497334-96497356 CCACACAGGCCAGGGACCCCCGA 0: 1
1: 0
2: 2
3: 29
4: 271
Right 1057605904 9:96497369-96497391 GAATCCGGAAGGCTTTGCTCAGG No data
1057605891_1057605906 14 Left 1057605891 9:96497334-96497356 CCACACAGGCCAGGGACCCCCGA 0: 1
1: 0
2: 2
3: 29
4: 271
Right 1057605906 9:96497371-96497393 ATCCGGAAGGCTTTGCTCAGGGG No data
1057605891_1057605907 15 Left 1057605891 9:96497334-96497356 CCACACAGGCCAGGGACCCCCGA 0: 1
1: 0
2: 2
3: 29
4: 271
Right 1057605907 9:96497372-96497394 TCCGGAAGGCTTTGCTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057605891 Original CRISPR TCGGGGGTCCCTGGCCTGTG TGG (reversed) Intronic
900408111 1:2501270-2501292 TCGGGGGCATCTGGCATGTGAGG + Intronic
901078663 1:6571353-6571375 TCAGGGGTCCCTGCCCAGCGTGG + Intronic
901452589 1:9345065-9345087 TCAGGGCTGCCTGGCCTGAGAGG - Intronic
902187505 1:14736213-14736235 TCCTGGGCCCCTGGCCTGTTGGG + Intronic
902323302 1:15683513-15683535 GTGGGGGTCTCTGGCCTGTGGGG + Intergenic
903353162 1:22730351-22730373 TCAGGGATCCCTGGCCTTTGGGG + Intronic
904849598 1:33447320-33447342 TGGGGGGTCCATGGCATATGGGG + Intergenic
905284626 1:36871284-36871306 TCGGGGGTGCCAGGCCTGAATGG - Intronic
906709305 1:47917209-47917231 TCCGGGGTTCCTGGCCTATCTGG - Intronic
909585301 1:77282148-77282170 GAGGGGGTCCCTGGCCTGGGCGG + Exonic
909592820 1:77370848-77370870 TCAGGAGGCCCTGGCCTGTCTGG - Intronic
913975306 1:143450741-143450763 TCGAGGGTCCCTTGGCTGAGGGG - Intergenic
914069699 1:144276357-144276379 TCGAGGGTCCCTTGGCTGAGGGG - Intergenic
914109456 1:144689997-144690019 TCGAGGGTCCCTTGGCTGAGGGG + Intergenic
915363505 1:155300603-155300625 TCGGGGGGTCCTGGGTTGTGCGG - Intronic
916641058 1:166729518-166729540 TCAGGGATCCAAGGCCTGTGGGG - Intergenic
918866529 1:189907447-189907469 TCGAGTGTCCCTGCCCAGTGAGG + Intergenic
920181368 1:204133987-204134009 CAGGGAGTCCCTGTCCTGTGAGG - Intronic
920366772 1:205452077-205452099 TCAGGTGTCCCTGGCCTGATTGG + Intronic
924385442 1:243495222-243495244 TGGGGCCTCCCTGGCCTGTGCGG + Intronic
924852241 1:247841885-247841907 TTGGGGCTCCATTGCCTGTGGGG + Exonic
1063561756 10:7134690-7134712 TGGGTGATCCCTGGCCTATGGGG - Intergenic
1063868331 10:10391024-10391046 TCGGGGGTGACTGTCCTTTGTGG - Intergenic
1065980172 10:30887166-30887188 TCAGTGGTCCCTGGCCTATAAGG - Intronic
1067412861 10:46079858-46079880 TTGGGGGTCCTTGGTCTGTGGGG - Intergenic
1067444318 10:46331099-46331121 TGGGGTGCCCATGGCCTGTGTGG - Intergenic
1067578807 10:47426168-47426190 TCGGGTGGCCCTGCCCAGTGAGG - Intergenic
1067944090 10:50679578-50679600 TGGGGGCACCCAGGCCTGTGAGG + Intergenic
1069588852 10:69629951-69629973 TGGGGGCGCCCTGGCCTGGGAGG - Intergenic
1070765542 10:79054076-79054098 GCGGGGGTGCCTGGCCTTGGGGG + Intergenic
1070795303 10:79212952-79212974 GCTGGGTTCCCTGACCTGTGAGG + Intronic
1070865584 10:79706448-79706470 TGGGGGCACCCAGGCCTGTGAGG + Exonic
1070879377 10:79844579-79844601 TGGGGGCACCCAGGCCTGTGAGG + Exonic
1071632485 10:87228669-87228691 TGGGGGCACCCAGGCCTGTGAGG + Exonic
1071645934 10:87360887-87360909 TGGGGGCACCCAGGCCTGTGAGG + Exonic
1072864211 10:99041555-99041577 TCAGGAGTCCAAGGCCTGTGGGG - Intronic
1076516835 10:131050478-131050500 TCTGGAGTCCCTGGCCTCAGGGG - Intergenic
1076571808 10:131438153-131438175 TCCGAGTTCCCTGCCCTGTGGGG + Intergenic
1078573065 11:12475966-12475988 TCCGGGGTGCTGGGCCTGTGTGG + Intronic
1079947231 11:26759421-26759443 TCTTGTGTCCCTGGTCTGTGAGG + Intergenic
1080646781 11:34193405-34193427 TGGGTGGGCCCTGGCCTTTGGGG - Intronic
1081262443 11:40977261-40977283 GCAGTGGTCCCTGGCCTGTTAGG - Intronic
1083686705 11:64380761-64380783 TGGGGAGTCCCTGGCCTGCTTGG + Intergenic
1084145010 11:67260626-67260648 TCAGGTGTCCCTGACCTCTGGGG - Intergenic
1084570222 11:69955203-69955225 GCAGGGGTCCCACGCCTGTGAGG + Intergenic
1084705239 11:70812517-70812539 TCGGGGTTCCCTGCTCTGTCTGG + Intronic
1084994599 11:72963845-72963867 TCAGCAGTCCATGGCCTGTGAGG - Intronic
1085270338 11:75266394-75266416 TCTGAGGTCTCTGGCCTCTGGGG + Intronic
1089693216 11:120199400-120199422 AAGGGGGACCCTGGGCTGTGTGG + Intergenic
1091448281 12:557361-557383 TCGTGGGTCCCCTGCCTGGGAGG + Intronic
1091891288 12:4056602-4056624 TCTGGGATCCCTGACCTGTTGGG - Intergenic
1096115595 12:49053045-49053067 CCGGGTGTGCCGGGCCTGTGGGG - Exonic
1096896501 12:54826095-54826117 AAGGGGGTCTCTGGTCTGTGGGG + Intergenic
1096973666 12:55686201-55686223 TTGGGGGTCCAGGGACTGTGGGG - Intronic
1102453027 12:113055782-113055804 ACGGGGGTCAGTGGCCTGTTTGG - Intergenic
1103737569 12:123070305-123070327 AAGCAGGTCCCTGGCCTGTGTGG + Intronic
1104919849 12:132285091-132285113 TCAGGGTTCCCTGGCGGGTGGGG + Intronic
1105504621 13:20998982-20999004 GCGGGGATCCCTGTCCTGCGTGG - Intronic
1105706614 13:22971333-22971355 TGGGGGATCACAGGCCTGTGAGG - Intergenic
1106117647 13:26831002-26831024 TCCAGGGCCCCTGGCCTGAGGGG - Intergenic
1106220942 13:27745758-27745780 TGGGAGGTCCCAGGACTGTGCGG + Intergenic
1106248659 13:27968295-27968317 TCGGGGGCCTCTGGCCCGTCGGG - Intronic
1106250393 13:27978080-27978102 TCCCGGGTCCCTGGCCCGCGCGG + Exonic
1111045144 13:82805191-82805213 TGGGGCTTCCCTGCCCTGTGTGG - Intergenic
1111826726 13:93276732-93276754 TCGGGAGTACCTGGGATGTGTGG + Intronic
1113421993 13:110178099-110178121 TCGGGGCTCCCTGGCCTTCCTGG - Exonic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1115640722 14:35334199-35334221 ATGGGGGTCCCTGGCCTTTAGGG + Intergenic
1117995118 14:61470932-61470954 TCGGTGGTCCCTGGGGAGTGAGG - Intronic
1120826490 14:88960805-88960827 TCGGGGGTGTGTGGCTTGTGAGG + Intergenic
1121671519 14:95714117-95714139 TCGCTGGTCCCTGGGATGTGGGG + Exonic
1122597067 14:102901151-102901173 TCGGGGGCCCCTGCTGTGTGGGG + Intronic
1122806775 14:104263795-104263817 TAGGGTGTCCCTGGCATGAGGGG + Intergenic
1122842489 14:104473230-104473252 TCTTGGCTCCCGGGCCTGTGAGG + Intergenic
1122972645 14:105158675-105158697 TGGGGGGTTCCTGGGCAGTGAGG - Intronic
1123161625 14:106284080-106284102 TAGTGGGTCCCAGGCCTGTGAGG + Intergenic
1124225418 15:27889510-27889532 TCTGGGGTACCTGGCCTGCCTGG + Intronic
1124720901 15:32110057-32110079 TCTTGGGGCCCTGACCTGTGTGG + Intronic
1124954881 15:34353835-34353857 TCTAGGGCCCCTGGCCTCTGAGG + Exonic
1127314486 15:57781813-57781835 TCTGGGGTGCCTGGCCTGCCTGG - Intronic
1128292005 15:66485155-66485177 CCGGGGGTCCTTGGCCTGGGTGG - Exonic
1128875433 15:71197662-71197684 TCGGTGCTCCATGGGCTGTGTGG + Intronic
1129163149 15:73758848-73758870 TCCGGGTCCCCTGTCCTGTGTGG + Intergenic
1130538149 15:84801748-84801770 TGGGGTGACCCTGGCCTGGGTGG + Intronic
1130955050 15:88621571-88621593 TCGGGGGTCCAGGGCCAGAGGGG + Intronic
1132899377 16:2244947-2244969 ACGGGGGTCCCTGGCTTGCTTGG - Intronic
1133027979 16:2996937-2996959 TTGGAGCTCCCAGGCCTGTGGGG - Intergenic
1133032363 16:3017559-3017581 CCGGGGGCCCCAGGCCTGGGCGG + Intronic
1133058253 16:3158280-3158302 TCGGAGGTCCCAGGGCTGCGAGG + Intergenic
1133118034 16:3589378-3589400 TGGGGGGTCACTGTCCAGTGGGG + Exonic
1136061707 16:27731106-27731128 CGGGGGGGTCCTGGCCTGTGTGG - Intronic
1136579707 16:31143807-31143829 TGGGGGGCCCCTGGTCTGTGAGG - Exonic
1137770520 16:51012693-51012715 TTGGGGGTCCCTTCCCTGTGGGG - Intergenic
1139371427 16:66471774-66471796 TGGGGAGTCCCTGGCTTCTGGGG - Intronic
1139711864 16:68782148-68782170 GTGGTGGTCCCTTGCCTGTGGGG - Intronic
1140861903 16:79025516-79025538 TCAGTGCTCCCTGGCTTGTGGGG - Intronic
1141595146 16:85092819-85092841 CCTGGGGTGCGTGGCCTGTGTGG - Exonic
1142015083 16:87741312-87741334 TTGGAGGTCCATGGCCTGTTAGG + Intronic
1142244293 16:88962434-88962456 GCTGGGGTCACTGTCCTGTGGGG + Intronic
1142308571 16:89299363-89299385 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308585 16:89299408-89299430 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308638 16:89299597-89299619 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308668 16:89299705-89299727 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308680 16:89299750-89299772 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308694 16:89299795-89299817 TGTGGGGTACCTGCCCTGTGTGG + Intronic
1142308707 16:89299840-89299862 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308753 16:89300002-89300024 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308778 16:89300092-89300114 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308790 16:89300137-89300159 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308804 16:89300182-89300204 TGTGGGGTGCCTGCCCTGTGTGG + Intronic
1142308818 16:89300227-89300249 TGTGGGGTGCCTGACCTGTGTGG + Intronic
1144813668 17:18018467-18018489 TCAGGGCTCCCCAGCCTGTGGGG - Exonic
1146915179 17:36673777-36673799 TCAGGGAGTCCTGGCCTGTGAGG + Intergenic
1148579400 17:48733288-48733310 TGGCGGGTCCCTAGCCTGGGTGG - Intergenic
1149664125 17:58353978-58354000 CTGTGGGTCCCTGGCCTGTATGG + Exonic
1151394754 17:73815279-73815301 TCAGTGGTCCATGGCCTGTTAGG - Intergenic
1152748637 17:82052463-82052485 TCGGGGGTCCCTGTCCTGGAAGG - Intronic
1155270742 18:24139229-24139251 TCGGGGGTGGGGGGCCTGTGGGG + Intronic
1157492358 18:48133102-48133124 TCCGGGGTTCCTGGCCTAGGAGG + Intronic
1157498135 18:48170929-48170951 TGAAGGGTCCCTGCCCTGTGGGG - Intronic
1157679527 18:49593664-49593686 TAGGGGACCCCTGGGCTGTGGGG - Exonic
1158960458 18:62583844-62583866 TCTGGGGTCCCAGGGCTGAGAGG + Intronic
1159721844 18:71899992-71900014 TCTGGGGTCCATGGCCTGTAGGG + Intergenic
1160741623 19:688925-688947 TCTCGGGCCCCTGCCCTGTGTGG - Intronic
1160772828 19:840775-840797 TCGGGGGTCCCTGGCCAGGTGGG - Intergenic
1160806658 19:995007-995029 TCGGGGGTCCCTGGTCCCTGTGG + Intronic
1160871097 19:1278402-1278424 TGGGGGGACCTTGGCCTGTTGGG + Intronic
1160895224 19:1399319-1399341 TCGGGGTTCTCAAGCCTGTGTGG - Intronic
1161100988 19:2421862-2421884 TGGGGGCCCCCTGGCCTGCGAGG + Exonic
1161278611 19:3433329-3433351 TGGGGGGTCCTTGTCCAGTGTGG - Intronic
1161390819 19:4019366-4019388 TCTGGGGTCCCTGCCCTGGGAGG - Intronic
1161403604 19:4080020-4080042 TCCTGGGTTCCTGCCCTGTGTGG - Intergenic
1161708251 19:5832395-5832417 GCGGGGGTCCCTGTGCTGTCTGG + Exonic
1162013301 19:7830636-7830658 ACGGGGGTCCTGGGCCTGCGGGG - Intronic
1163023456 19:14495972-14495994 TCGGGGGTCGCGGGCCTGCGAGG - Intronic
1163270178 19:16248354-16248376 GCTGGGGTCCCTGGCCTGGCTGG + Intergenic
1163646773 19:18494010-18494032 TTGGGGGCCTCTGGTCTGTGTGG - Intronic
1163744610 19:19037901-19037923 CCAGTGGTCCCTGGCCTGTTAGG + Intronic
1164667871 19:30053417-30053439 TCGGAGCTCCCTGGCCTGCTTGG + Intergenic
1164888381 19:31802823-31802845 TCCGGGGACCCTGGCTTTTGAGG + Intergenic
1165152073 19:33766774-33766796 TGGAGGCTCCCTGGCCTGTTGGG + Intronic
1165363667 19:35351434-35351456 TCGCGGGTTCCAGCCCTGTGTGG - Intergenic
1166231152 19:41426520-41426542 GCTGGGGTCCCTGCCCAGTGGGG - Exonic
1167000833 19:46745379-46745401 TTGGGGATCCCGGGCATGTGTGG - Intronic
1167382744 19:49148260-49148282 TGGGGGCTGCCTGGCCAGTGGGG + Intronic
1167666569 19:50825918-50825940 TGGGGGACCCCTGGTCTGTGGGG - Exonic
1168100879 19:54140269-54140291 TTGTGGGTCCCTTCCCTGTGGGG + Intronic
1168242682 19:55095344-55095366 ACGGAGCTCCTTGGCCTGTGTGG + Exonic
927864204 2:26578287-26578309 TGGGTGGTGCCTGGCCTGGGAGG + Intronic
932886913 2:75556900-75556922 TGGCTGGTCCCTGGCCTGTTAGG - Intronic
933484037 2:82896223-82896245 TCAGGAGGCCCTGCCCTGTGAGG - Intergenic
934180006 2:89611714-89611736 TCGAGGGTCCCTTGGCTGAGGGG - Intergenic
934290301 2:91685975-91685997 TCGAGGGTCCCTTGGCTGAGGGG - Intergenic
936080587 2:109429982-109430004 TAGGGGCTCAGTGGCCTGTGTGG - Intronic
938243316 2:129759333-129759355 CCGGGGGTCCATGGCATCTGTGG + Intergenic
938710438 2:133972073-133972095 CAGGGTGTCCCTGTCCTGTGTGG - Intergenic
939494679 2:142914052-142914074 TCAGGGATCCAAGGCCTGTGCGG + Intronic
942206574 2:173625408-173625430 GCGGGGGGCCCTGGCCAGAGAGG + Intergenic
945426429 2:209710057-209710079 TTGGGGGTTCCTGGTGTGTGAGG - Exonic
948255963 2:236568113-236568135 TCCGGGGTCCCCGGCCCATGTGG + Intronic
948660478 2:239503535-239503557 TCTGGGGTTCCTGGGCTGTGGGG - Intergenic
948660707 2:239504868-239504890 CCGGGGGCCCCAGGCCGGTGGGG + Intergenic
948868653 2:240787510-240787532 TCAGGGGTCCCTGGCTGGTGTGG + Intronic
948977469 2:241472332-241472354 TCAGGGGACCCTGTTCTGTGGGG + Intronic
949032870 2:241805255-241805277 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949032886 2:241805294-241805316 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949032917 2:241805372-241805394 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949032933 2:241805411-241805433 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949032950 2:241805450-241805472 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949032967 2:241805489-241805511 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949032984 2:241805528-241805550 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033031 2:241805641-241805663 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033077 2:241805754-241805776 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033197 2:241806048-241806070 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033213 2:241806087-241806109 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033230 2:241806126-241806148 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033245 2:241806161-241806183 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033289 2:241806270-241806292 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033321 2:241806349-241806371 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033353 2:241806426-241806448 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033386 2:241806504-241806526 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033416 2:241806578-241806600 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033432 2:241806617-241806639 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033478 2:241806730-241806752 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033509 2:241806804-241806826 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033525 2:241806843-241806865 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033541 2:241806882-241806904 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033572 2:241806960-241806982 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033648 2:241807147-241807169 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033740 2:241807381-241807403 TCCCGGGTCCCTGGCGTGAGGGG - Intergenic
949033753 2:241807420-241807442 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033770 2:241807459-241807481 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033802 2:241807536-241807558 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033853 2:241807661-241807683 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033900 2:241807778-241807800 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033917 2:241807817-241807839 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
949033969 2:241807942-241807964 GCGGAGGTCCCTGGGCTGAGGGG - Intergenic
1168734060 20:115286-115308 TCAGGGATCCAGGGCCTGTGGGG - Intergenic
1172055463 20:32151404-32151426 TCGGGGATCCCTGGGAGGTGAGG - Intronic
1172278367 20:33693767-33693789 GCTGGGTTTCCTGGCCTGTGTGG - Intergenic
1175224342 20:57436189-57436211 TTGGGGATCTCTTGCCTGTGCGG + Intergenic
1175921201 20:62451295-62451317 TGGTGGGGCCCAGGCCTGTGGGG + Intergenic
1175926099 20:62472336-62472358 TCCTGGGGCCCTGGGCTGTGGGG - Intronic
1175987539 20:62771435-62771457 TCGGGGGCCCCTGACCTCTCTGG + Intergenic
1176122673 20:63461231-63461253 TGGGGGGGCCTTGGCCTGAGCGG - Intronic
1176196198 20:63837202-63837224 CCAGGGGCCCCTGGCCTCTGAGG + Intergenic
1176388719 21:6152494-6152516 GCAGGGGTCCCTGGTGTGTGTGG - Intergenic
1176388751 21:6152640-6152662 GCGGGGGTCCCTGGTGTGTGTGG - Intergenic
1176614582 21:9017287-9017309 AGGAGGGTCCCTGGCCTGGGGGG + Intergenic
1177393799 21:20508132-20508154 TCAGGGATCCAGGGCCTGTGGGG + Intergenic
1179719363 21:43306600-43306622 TTGGGGCTCCCTGGCTTGTGGGG - Intergenic
1179734721 21:43385608-43385630 GCGGGGGTCCCTGGTGTGTGTGG + Intergenic
1179734753 21:43385754-43385776 GCAGGGGTCCCTGGTGTGTGTGG + Intergenic
1179821447 21:43939585-43939607 TCGCGGGCGCCTGGCCTGTCCGG + Intronic
1179921545 21:44510243-44510265 GCAGGGATCCCCGGCCTGTGGGG - Intronic
1180180216 21:46115591-46115613 GTGGGGGTGCCTGGCCCGTGGGG - Intronic
1180981166 22:19878674-19878696 ACGGGGGTCCCAGGCCTGGGTGG - Intronic
1181346967 22:22226454-22226476 TCAGGGGTCACTGGACTGTTTGG - Intergenic
1182478256 22:30588817-30588839 CTGGCGGTCCCTGGCCTTTGTGG - Intronic
1185197284 22:49479800-49479822 TCACGAGTCCCTGTCCTGTGTGG - Intronic
1185314229 22:50171787-50171809 TCAGGGTCTCCTGGCCTGTGTGG + Intronic
1185388492 22:50547192-50547214 TCGGGGGTCCCTGCCCCCGGAGG + Intergenic
950016315 3:9757261-9757283 TTGGGGGTGCCTGGCCTTTGAGG - Intronic
951189291 3:19749675-19749697 TCAGGGATCCATGGCCTGTGGGG + Intergenic
951963006 3:28349293-28349315 TGGGGGGTCCCCGGGCCGTGTGG + Intronic
954372237 3:50174994-50175016 ACGTGTGTTCCTGGCCTGTGTGG + Intronic
956173444 3:66451522-66451544 TTGGGGGACTCTGGGCTGTGTGG - Intronic
958864477 3:99485197-99485219 TGGGGGGTCCCTGGCTCCTGTGG + Intergenic
959665612 3:108917649-108917671 TCAGTGTTCCCTGGCCTGAGAGG + Intronic
961521022 3:127467416-127467438 ATGGGGGTCCCTGGCCAGGGAGG + Intergenic
962744013 3:138384039-138384061 AGGGGTGTGCCTGGCCTGTGTGG + Intronic
966881933 3:184355419-184355441 TGGTGGGTTCCAGGCCTGTGAGG + Exonic
968428322 4:537559-537581 TGTGGGGTCCCCGGCCTGTGGGG + Intronic
968942328 4:3645246-3645268 CCGAGGATCCCTGCCCTGTGCGG + Intergenic
969045003 4:4330294-4330316 TTGGTGCTCCCTGGCCTGTGGGG - Intergenic
969330318 4:6470928-6470950 TCGGGGCGCCCTGGCCCGGGAGG - Intronic
969486046 4:7472999-7473021 TATGGAGCCCCTGGCCTGTGGGG + Intronic
969829273 4:9781916-9781938 TCGAGGGTCCCTTGGCTGAGGGG + Exonic
970962541 4:21889776-21889798 TCGGTCTTGCCTGGCCTGTGTGG - Intronic
971283225 4:25259857-25259879 TTGTGGGTCCCTGGACTGTCAGG + Intronic
975249323 4:72159855-72159877 ACGGAGGTCCGTGGCCTGTTAGG + Intergenic
977097220 4:92761614-92761636 TCAGTGGTCCTTGGGCTGTGAGG + Intronic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
980184560 4:129446004-129446026 TGGGGGGTCCCTGCCCTGTGTGG - Intergenic
985663273 5:1168059-1168081 GCCGGGGGCCCTGTCCTGTGGGG - Intergenic
988953305 5:36287267-36287289 ACAGGGGTCCATGGCCTGTTAGG - Intronic
990984153 5:61626254-61626276 TCGGGGGTTCCTGGGCCGGGTGG + Intergenic
992460851 5:76958518-76958540 TCAGGAGGCCCTGGGCTGTGAGG - Intronic
994774301 5:104024784-104024806 CCTGGGGTCCCTGGCACGTGAGG - Intergenic
997472668 5:134125402-134125424 TCGGGGCTCCCTGGCAAGGGAGG - Intronic
998312642 5:141150912-141150934 TCGGAGGTCCCTGACCGGGGCGG - Exonic
1001110421 5:168891496-168891518 TAGGGAATCCCTGGTCTGTGAGG - Intronic
1002053564 5:176585682-176585704 TCGGTCTTCTCTGGCCTGTGTGG - Intronic
1002103605 5:176869280-176869302 CTGGGGGTGCCTGGACTGTGTGG - Intronic
1002387088 5:178876233-178876255 TCGGGAGGCCCTGTCCAGTGAGG + Intronic
1002536324 5:179878224-179878246 CCTGTGGTCCCAGGCCTGTGTGG - Intronic
1007276128 6:40675385-40675407 TCAGGGGGCCCTAGCCTGAGGGG + Intergenic
1008497280 6:52145884-52145906 TCGGGGGTTCCTGGCATCTAGGG + Intergenic
1015886760 6:137925923-137925945 TTGGGGGTCCCAGTCCTGTATGG - Intergenic
1017966970 6:159275442-159275464 TGGTCAGTCCCTGGCCTGTGGGG + Intergenic
1018736656 6:166691579-166691601 TCGGAGCTCCCTGGACTCTGAGG - Intronic
1019622364 7:1998815-1998837 TAGGGGGTCTGTGGACTGTGGGG - Intronic
1023294855 7:38703948-38703970 TGGGGGCTCCCTGTCTTGTGAGG + Intergenic
1026867093 7:73830647-73830669 TGAGGGGGCACTGGCCTGTGGGG + Exonic
1028041426 7:86058941-86058963 TCAGGGATCCAAGGCCTGTGGGG + Intergenic
1028779571 7:94720111-94720133 CGGGGGCTCCCTGCCCTGTGCGG + Intergenic
1029688695 7:102166082-102166104 ACGAAGGTCCCTGGCATGTGTGG - Intronic
1034304646 7:150039134-150039156 TCGGGGGTCCTAAGCCGGTGGGG + Intergenic
1034425092 7:151009950-151009972 TCGGGGGCCCCTGGCCGGACTGG - Intronic
1035721780 8:1798171-1798193 TCTGGGGTCCCTGGGGTGCGGGG + Intergenic
1035865850 8:3080816-3080838 TCAGGGCTCCCTGGCCTTTTGGG + Intronic
1037812302 8:22094384-22094406 CAGGGGCTCCCTGGCCTTTGTGG + Intronic
1037887839 8:22604486-22604508 TCGGGGGTCCCTTGTGTTTGGGG + Intergenic
1038583503 8:28770117-28770139 CCGGGGCTCTGTGGCCTGTGAGG - Intronic
1038720255 8:30028578-30028600 CCTGGGGTCCTTGGCCTGGGTGG - Intergenic
1039463250 8:37763123-37763145 TCGGGCGTCTCTGGCCTCCGCGG - Intronic
1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG + Intergenic
1047499790 8:125431877-125431899 GCGAGGGTTCCTGGCCGGTGTGG - Intronic
1049324621 8:142015570-142015592 TGGGGGCTCCCCGGCCTGGGAGG - Intergenic
1049369904 8:142259379-142259401 TCTGGGGTCCCAGGCCTGAGAGG + Intronic
1049466386 8:142752878-142752900 TGGGGGGTCCCTGGGCTGCCTGG - Intergenic
1049491240 8:142904231-142904253 TCGGGGATCCAAGGCCTGTGAGG - Intronic
1049687922 8:143946398-143946420 TCGGAGCAGCCTGGCCTGTGTGG - Intronic
1049854629 8:144853464-144853486 GCGGGCGTCCCTGTCCCGTGTGG + Exonic
1053285366 9:36846761-36846783 TCGAGGGACCCAGGCCAGTGAGG + Intronic
1053411413 9:37918305-37918327 TCGGGGCTGCCTGGCCTGTGTGG + Intronic
1057355032 9:94325506-94325528 TGGGGGCACCCAGGCCTGTGAGG - Exonic
1057605891 9:96497334-96497356 TCGGGGGTCCCTGGCCTGTGTGG - Intronic
1057652719 9:96932128-96932150 TGGGGGCACCCAGGCCTGTGAGG + Exonic
1059173489 9:112148526-112148548 TCGGGGGTCCTTGGGGTGAGTGG - Intronic
1062243715 9:135552802-135552824 CCGGGGGTGCCCGCCCTGTGAGG - Intergenic
1062400305 9:136369898-136369920 TGGGGGGCCTCAGGCCTGTGGGG - Intronic
1062444409 9:136587672-136587694 TCGGAGGTCGCTGCCCAGTGTGG + Intergenic
1062457024 9:136644734-136644756 CCGGGGGTCCTTGGCCTCCGTGG - Intergenic
1062607900 9:137356221-137356243 GCGGCTCTCCCTGGCCTGTGGGG + Intronic
1185942148 X:4333707-4333729 TAGGGGCTCACTGGCCTGGGTGG + Intergenic
1186857264 X:13638288-13638310 TGGGTAGTCCTTGGCCTGTGAGG + Intergenic
1189695389 X:43656439-43656461 CTGGGGGACCCTGGCCAGTGAGG + Intronic
1190135945 X:47798010-47798032 TCTGGGGTCCCTCAGCTGTGGGG + Intergenic
1195051164 X:101098206-101098228 TCGGTGGTCAGAGGCCTGTGCGG + Intronic
1197365630 X:125562104-125562126 TCGGGAGTCCCTGCCCAGTGAGG - Intergenic
1200122558 X:153798017-153798039 TCAGGGGTGCCTGGCGTGTGGGG - Intronic
1202195835 Y:22297705-22297727 TGGGGTGTCACTGGCCTGTTAGG - Intergenic