ID: 1057611724

View in Genome Browser
Species Human (GRCh38)
Location 9:96550207-96550229
Sequence AGGTGGGTAGGAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7021
Summary {0: 1, 1: 0, 2: 21, 3: 442, 4: 6557}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057611724_1057611732 21 Left 1057611724 9:96550207-96550229 CCCTCTTCCCTTCCTACCCACCT 0: 1
1: 0
2: 21
3: 442
4: 6557
Right 1057611732 9:96550251-96550273 TGAGCCATGAGCTAGCAGAAAGG No data
1057611724_1057611733 22 Left 1057611724 9:96550207-96550229 CCCTCTTCCCTTCCTACCCACCT 0: 1
1: 0
2: 21
3: 442
4: 6557
Right 1057611733 9:96550252-96550274 GAGCCATGAGCTAGCAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057611724 Original CRISPR AGGTGGGTAGGAAGGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr