ID: 1057613535

View in Genome Browser
Species Human (GRCh38)
Location 9:96567613-96567635
Sequence TTTAAATGGTTGTTTAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1084
Summary {0: 1, 1: 1, 2: 6, 3: 108, 4: 968}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057613535_1057613538 4 Left 1057613535 9:96567613-96567635 CCCTTTTTAAACAACCATTTAAA 0: 1
1: 1
2: 6
3: 108
4: 968
Right 1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG No data
1057613535_1057613544 28 Left 1057613535 9:96567613-96567635 CCCTTTTTAAACAACCATTTAAA 0: 1
1: 1
2: 6
3: 108
4: 968
Right 1057613544 9:96567664-96567686 TGGTTATCGGAGGCTGGGAAAGG No data
1057613535_1057613541 18 Left 1057613535 9:96567613-96567635 CCCTTTTTAAACAACCATTTAAA 0: 1
1: 1
2: 6
3: 108
4: 968
Right 1057613541 9:96567654-96567676 AGTAGAAGGATGGTTATCGGAGG No data
1057613535_1057613543 23 Left 1057613535 9:96567613-96567635 CCCTTTTTAAACAACCATTTAAA 0: 1
1: 1
2: 6
3: 108
4: 968
Right 1057613543 9:96567659-96567681 AAGGATGGTTATCGGAGGCTGGG No data
1057613535_1057613542 22 Left 1057613535 9:96567613-96567635 CCCTTTTTAAACAACCATTTAAA 0: 1
1: 1
2: 6
3: 108
4: 968
Right 1057613542 9:96567658-96567680 GAAGGATGGTTATCGGAGGCTGG No data
1057613535_1057613539 8 Left 1057613535 9:96567613-96567635 CCCTTTTTAAACAACCATTTAAA 0: 1
1: 1
2: 6
3: 108
4: 968
Right 1057613539 9:96567644-96567666 AGAGATAGAGAGTAGAAGGATGG 0: 26
1: 280
2: 840
3: 2118
4: 5704
1057613535_1057613540 15 Left 1057613535 9:96567613-96567635 CCCTTTTTAAACAACCATTTAAA 0: 1
1: 1
2: 6
3: 108
4: 968
Right 1057613540 9:96567651-96567673 GAGAGTAGAAGGATGGTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057613535 Original CRISPR TTTAAATGGTTGTTTAAAAA GGG (reversed) Intronic
900338122 1:2174812-2174834 TTTAAAAGGATTTTTAAATAAGG + Exonic
901284303 1:8064772-8064794 TTAAAACAGTTTTTTAAAAAAGG - Intergenic
901780212 1:11589194-11589216 TTTAAATTTTTTTTTAAACAGGG - Intergenic
903194907 1:21678432-21678454 CTTAGATCATTGTTTAAAAAAGG - Intronic
903310370 1:22451001-22451023 TTTAAATGTTTGTGTAAGGAAGG + Intergenic
903317926 1:22523259-22523281 TTTTAATAGTTCCTTAAAAATGG - Intronic
903571951 1:24312213-24312235 TATAAATGGATTTTTAAAATAGG + Intergenic
903912797 1:26740462-26740484 TTTAAGTGGTTAGTTACAAAGGG + Intronic
904089403 1:27934313-27934335 TTTTAAAAGTTGTTTAAATAGGG + Intergenic
904282410 1:29430012-29430034 ATTCTATGGTTGTTTAAAAGAGG - Intergenic
904664958 1:32113218-32113240 TTTAAATGTTTTTTTAGAGATGG - Intronic
904733107 1:32610031-32610053 TTTAAAGCTTTTTTTAAAAATGG - Intronic
904886886 1:33745212-33745234 ATTAAATATTTGTTTATAAATGG + Intronic
905115069 1:35631708-35631730 TTTAAAAGTTTATTTTAAAAAGG + Intronic
905553721 1:38864901-38864923 TTTAAAGGTTTATATAAAAAGGG - Intronic
906028752 1:42699629-42699651 TTTAAATTGTTTTGTAGAAATGG + Intronic
907150613 1:52283629-52283651 TTTATATGGTTTTCTAAAACAGG + Intronic
907176554 1:52528575-52528597 TATTAATGTTTGTTTAGAAACGG - Intronic
907914335 1:58854743-58854765 TTTTAATTATTGTTTTAAAAAGG - Intergenic
908580369 1:65509841-65509863 TTTAAAAGGGAGTTTTAAAAGGG + Intronic
908791281 1:67784568-67784590 TTTACATGTTTGTTTATTAATGG + Intronic
908994614 1:70136413-70136435 GTTAAATAATTTTTTAAAAAAGG - Intronic
909098416 1:71319199-71319221 TATAAATTCATGTTTAAAAAAGG + Intergenic
909225239 1:73011838-73011860 TTTAAAAGATTGTTTAAAAATGG - Intergenic
909225617 1:73017731-73017753 TTTAAAACATTTTTTAAAAAAGG + Intergenic
909245485 1:73276755-73276777 ATAAAATGATTGTTTCAAAAAGG - Intergenic
909417861 1:75427792-75427814 TTTCAATGGCTTTTTAATAAGGG - Intronic
909442911 1:75717715-75717737 TTCAAATGGTTATTAAGAAATGG + Intergenic
909650406 1:77969715-77969737 TTTAAAAAATTTTTTAAAAAAGG - Intronic
909681081 1:78293057-78293079 TTTAAATTGTTCTTTCAATAAGG + Intergenic
909733064 1:78919878-78919900 TTTAAATGGACGTTAAACAAAGG - Intronic
909779682 1:79527642-79527664 TTTAACTGGGTGGTTTAAAAAGG - Intergenic
909984527 1:82144267-82144289 TTAAAAAGTTTGTTTAAAAGAGG + Intergenic
910116035 1:83732842-83732864 TTAAAATCGTTATTCAAAAATGG - Intergenic
910153326 1:84182083-84182105 TTTAAATGGATAGTTATAAATGG + Intronic
910210313 1:84785404-84785426 ATTAATTGGTTGTTTGAAATGGG - Intergenic
910340954 1:86186701-86186723 TTCAAATGTTTGCTTAAAAATGG + Intergenic
910424493 1:87106244-87106266 TTTCAATAGTTGTTGAAACATGG - Exonic
910445239 1:87293277-87293299 TTTAAATGATGTTATAAAAAAGG - Intergenic
910489743 1:87755981-87756003 TATGATTGTTTGTTTAAAAATGG + Intergenic
911288472 1:96027348-96027370 TTTAAATTGAATTTTAAAAAGGG + Intergenic
911353295 1:96783200-96783222 TTTAAATAGTTGGTTAAAGGAGG - Intronic
911436311 1:97863748-97863770 TTTGAAGGGTTTTTTAAAATTGG - Intronic
911478701 1:98408529-98408551 TTGCAATGGTTCTTTAATAAAGG + Intergenic
911592511 1:99764558-99764580 TTTAAATGGATCTTGAAAGAGGG - Intronic
911872961 1:103122517-103122539 TAAAATTGGTTGTTTTAAAATGG - Intergenic
911944526 1:104089704-104089726 ATTAAATGGTTATGTAAAATTGG + Intergenic
912101484 1:106212033-106212055 TTTTAGTATTTGTTTAAAAATGG - Intergenic
912138209 1:106687772-106687794 GTTAAATGGATTTTTAGAAAAGG - Intergenic
912199611 1:107441567-107441589 TTCACATGGTTCCTTAAAAATGG - Intronic
912325247 1:108752031-108752053 TTTAAAAGGTATTATAAAAAGGG - Intronic
912988141 1:114455613-114455635 TACAGATGGTTGTTTTAAAATGG + Intronic
912992428 1:114501890-114501912 TTTAAATATTTTTCTAAAAATGG + Intronic
913248561 1:116892071-116892093 AATAAATAGTTTTTTAAAAAAGG - Intergenic
913672302 1:121108633-121108655 TTTAAATAGAAATTTAAAAATGG - Intergenic
914024066 1:143895994-143896016 TTTAAATAGAAATTTAAAAATGG - Intergenic
914662556 1:149804025-149804047 TTTAAATAGAAATTTAAAAATGG - Intronic
914697032 1:150093299-150093321 TGTAAAGGATTTTTTAAAAATGG - Intronic
914712420 1:150226792-150226814 TTTAAATGATTTTTTAAAGATGG - Exonic
914756508 1:150564748-150564770 TTTAAATGGTTGAAAAAAATGGG - Intergenic
915061768 1:153191955-153191977 TGTCAATGGTTGTTGAATAATGG - Intergenic
915332766 1:155123917-155123939 TTTAAAACATTGTTTACAAAGGG + Intergenic
915804470 1:158829923-158829945 TTAAAATAGTTTTTAAAAAATGG - Intergenic
916095946 1:161350214-161350236 TTTAAACAATTTTTTAAAAATGG + Intronic
916470950 1:165121866-165121888 TATAAATGCTTGTTAAAGAATGG - Intergenic
917070928 1:171149751-171149773 TTTAAATGGGTACTTAAAAATGG + Exonic
917078523 1:171232613-171232635 TTTAAAAGGTTCTTTACAGAAGG - Intergenic
917107947 1:171513645-171513667 TCTAAATAGTTGTTGAAAGAAGG - Intronic
917315642 1:173722263-173722285 CTTAAATGGTTGAGGAAAAAAGG + Intronic
917369736 1:174279063-174279085 TTTAAGTAATTGTTTATAAAAGG - Intronic
917555619 1:176084820-176084842 TTTTATTGGTTGTTAAAAACTGG - Intronic
918090712 1:181291839-181291861 CCTAAAGGGTTTTTTAAAAAGGG - Intergenic
918436151 1:184515294-184515316 TTAAAATTGATTTTTAAAAAGGG + Intronic
918983291 1:191591492-191591514 TTTAAATGGTCTTTTTAAAATGG + Intergenic
919013565 1:191997652-191997674 TAGAAATAGTTTTTTAAAAACGG + Intergenic
919064174 1:192672072-192672094 TTTAAATGATTGTTATCAAATGG + Intergenic
919269199 1:195316966-195316988 TATCAATGTTTGTATAAAAAAGG - Intergenic
919298905 1:195735765-195735787 AATAACTGGTTGTTTAAAAAGGG + Intergenic
919596909 1:199575691-199575713 TTTTAATGCTTGTTTGCAAATGG + Intergenic
920373537 1:205494149-205494171 TTTAAATATTTGTTCAAAATAGG + Intergenic
920798719 1:209166613-209166635 TTTAAATGGTTTTGGAAATAGGG - Intergenic
920922072 1:210306071-210306093 TATTATTGGTTTTTTAAAAAGGG - Intergenic
921117758 1:212110501-212110523 TTTAAAGGGTTTTTTTTAAAAGG + Intergenic
921117840 1:212111241-212111263 TTGAACTGGATCTTTAAAAATGG - Intergenic
921344823 1:214172075-214172097 TTTAAAAAATTATTTAAAAATGG - Intergenic
921362615 1:214343736-214343758 CTTGAATGGTTATTAAAAAATGG - Intergenic
921375223 1:214466338-214466360 TCTAAATATTTGTTAAAAAAAGG - Intronic
921426596 1:215009262-215009284 TTTAAGTAGTAGTATAAAAATGG - Intronic
921460167 1:215415694-215415716 TTTAAAAGGTGTTTTTAAAAGGG + Intergenic
921462812 1:215448951-215448973 TTTAAAAGGTGTTTTTAAAAGGG - Intergenic
921885334 1:220299377-220299399 TTTAAATTGTTGTTTTTATAAGG + Intergenic
922491744 1:226022888-226022910 TTAAAATGTTTATATAAAAAGGG - Intergenic
923403179 1:233635460-233635482 TTTGAATTGTTGAGTAAAAATGG + Intronic
923742830 1:236671765-236671787 TTTAAATGGAGATTTAAAAATGG - Intergenic
924052186 1:240090599-240090621 TTAAAATTCTTTTTTAAAAAAGG - Intronic
924270668 1:242329308-242329330 TTTAAATTGTTTTATGAAAAAGG - Intronic
924317896 1:242817422-242817444 TCTAAATGTTTTTTGAAAAATGG - Intergenic
924456999 1:244226876-244226898 ATTATATGGTTGCTTAAAATAGG + Intergenic
1063293137 10:4772042-4772064 TTTAGAAGGTTGTTTAAGAGTGG - Intergenic
1064062540 10:12150713-12150735 TTTAAATGGATGCTTAGGAATGG + Intronic
1064721139 10:18230126-18230148 TTTACATAGTTGGTTCAAAAGGG + Intronic
1065264943 10:23965186-23965208 TTTAGAATGTTGTTTCAAAAAGG + Intronic
1065505270 10:26424217-26424239 GTAAAATGTTTATTTAAAAATGG - Intergenic
1065539507 10:26747653-26747675 TTCAAAAGATTATTTAAAAAAGG + Exonic
1065627186 10:27642915-27642937 TTTTGGTGGTTGTTTAAAACTGG + Intergenic
1065769690 10:29066287-29066309 TTTAAAAGGATCTTTAAAAGGGG - Intergenic
1065924589 10:30424436-30424458 TTTAAAATATTGTTTTAAAAAGG + Intergenic
1065998033 10:31078143-31078165 TGTAATTGGTTGATTAGAAATGG - Intergenic
1066274890 10:33859024-33859046 TTTAAAGATTTGTTTAAAAGAGG + Intergenic
1067073751 10:43159906-43159928 TTTAAAAGGTTAATTAAAACTGG + Intronic
1067242510 10:44508552-44508574 ATTAAAGGGATGTTTCAAAAGGG - Intergenic
1067972190 10:50985507-50985529 TTTAAAGGATATTTTAAAAATGG + Intergenic
1068247005 10:54385741-54385763 TTTATTTGATTTTTTAAAAAGGG - Intronic
1068426628 10:56873949-56873971 TTTAAATGCATGTTTCAAAAAGG + Intergenic
1068865619 10:61892533-61892555 TTTACATCCTTTTTTAAAAAAGG - Intergenic
1069219094 10:65860983-65861005 TTTAACTGGTTGATATAAAATGG - Intergenic
1069457382 10:68563380-68563402 TTTAAAACATTTTTTAAAAAAGG - Intronic
1069577967 10:69544220-69544242 TTTAAATAAATGTTTCAAAAAGG - Intergenic
1069736359 10:70657415-70657437 TTTACTTTGTTTTTTAAAAATGG - Intergenic
1069966533 10:72122599-72122621 TTTAAATTGTTTTGTAAAGATGG - Intronic
1070051165 10:72891181-72891203 TATAAATGGTAATTTAAATAGGG - Intergenic
1070068125 10:73058208-73058230 TTTAGATGGTTATTAAGAAATGG + Intronic
1070467929 10:76743572-76743594 TAAAAATGCTTTTTTAAAAAGGG - Intergenic
1071558289 10:86623963-86623985 TATAAATGATTACTTAAAAAAGG + Intergenic
1072081690 10:92039220-92039242 GGTAAATGGATTTTTAAAAAAGG + Intergenic
1072289445 10:93949683-93949705 TTTAACTATTTCTTTAAAAAAGG + Intronic
1072559302 10:96555731-96555753 TTGAAATGTTTGCTCAAAAAAGG + Intronic
1072753639 10:98002347-98002369 TTTAAATTTATTTTTAAAAAAGG - Intronic
1072820079 10:98547885-98547907 TTTAAATGAATGTTTAAACATGG - Intronic
1072941376 10:99767239-99767261 TTAATAAGGCTGTTTAAAAATGG + Intergenic
1073384756 10:103116123-103116145 ATAAAATGGTTTTTTTAAAAAGG - Intronic
1073780656 10:106834773-106834795 TTGAAATGATTTTTTAAAAATGG - Intronic
1074090847 10:110253477-110253499 TTAAGATATTTGTTTAAAAAGGG + Intronic
1074094757 10:110301720-110301742 TTTAAATGGTTATAGAAAAGAGG + Intronic
1074194525 10:111170388-111170410 TTTAAATACTTTTTTTAAAATGG + Intergenic
1074473909 10:113752424-113752446 ATTCTATGGTTGTTTAATAATGG - Intronic
1074505309 10:114064784-114064806 TTTAAATGTTTGTTAAAAATAGG + Intergenic
1074642846 10:115407920-115407942 TTAAAATGGCTGTGTTAAAATGG - Intronic
1075059868 10:119248697-119248719 TTTAAATGGTTAAAAAAAAAAGG + Intronic
1075251995 10:120887491-120887513 TTTAAATTGCTATCTAAAAATGG + Intronic
1075318858 10:121473310-121473332 AGTGAATGCTTGTTTAAAAAGGG + Intergenic
1075500624 10:122970548-122970570 TTGTAATGATTGTTTAAAAGAGG + Intronic
1075911240 10:126127368-126127390 TTTAAATAGTTTTTAAAAAGTGG + Intronic
1076173026 10:128338834-128338856 TTTCAATGGTTGGTTGAACAAGG - Intergenic
1076211717 10:128652285-128652307 GTTATATGGCTGTTTACAAATGG + Intergenic
1076490206 10:130855488-130855510 GTTAAATAATTGTTCAAAAACGG + Intergenic
1077292591 11:1805274-1805296 TTTAAATAGTTTTTAAAAATAGG - Intergenic
1077576887 11:3390754-3390776 TTTGTAGGGTGGTTTAAAAAAGG - Intergenic
1077737865 11:4810167-4810189 TTTGAATGCTTGTGCAAAAAAGG + Intronic
1078206751 11:9236570-9236592 TTTAAATAGTAAATTAAAAATGG + Intronic
1078228712 11:9418537-9418559 TTTAAAGATTTGTTTCAAAAAGG + Intronic
1078612343 11:12831491-12831513 TTGAAATGGTTTTTAAAAATAGG + Intronic
1078734651 11:14008840-14008862 TTTAAATTGTTCTTTTAAGAAGG - Intronic
1078940413 11:15997791-15997813 TTTTAATTGTTGATTAACAATGG - Intronic
1079372324 11:19862199-19862221 CTTAAAAAGTTTTTTAAAAAGGG + Intronic
1079619596 11:22537032-22537054 TTTAGTTAGTTGTGTAAAAAGGG + Intergenic
1079798756 11:24842555-24842577 TTTATTTTGTAGTTTAAAAAAGG - Intronic
1079831123 11:25269331-25269353 TGTAAATTATTGTTTCAAAATGG + Intergenic
1080157777 11:29132625-29132647 TTTAAATACTTCTGTAAAAATGG + Intergenic
1080185171 11:29474419-29474441 TAGAAATAGTTTTTTAAAAAAGG + Intergenic
1080290103 11:30661367-30661389 TTGAAATAGTAGTTAAAAAAAGG - Intergenic
1080396655 11:31896177-31896199 TTTAAAAGTTATTTTAAAAATGG + Intronic
1080732525 11:34973996-34974018 TTTAAAAAATTGTTTTAAAAAGG - Intronic
1081440517 11:43076002-43076024 TTTAAAAAGTAGTTAAAAAAGGG - Intergenic
1083833591 11:65249486-65249508 TTTAAATAATTGTTTAATTATGG + Intergenic
1083921500 11:65783486-65783508 TTTAAAATGGTGTTTAAAAAGGG + Intergenic
1083969324 11:66063814-66063836 GTTCAATAATTGTTTAAAAAAGG - Intronic
1084299924 11:68241920-68241942 TTTAAATTGTATTTTAAAAGTGG + Intergenic
1084624851 11:70298522-70298544 TATAAATGGTTGTTATTAAAAGG + Intronic
1085185575 11:74573296-74573318 AATAAATGTTTGCTTAAAAAGGG - Intronic
1085480081 11:76814676-76814698 AATAATTGGTTGTTTAAAAGAGG - Intergenic
1086128623 11:83377181-83377203 TTTTAATAGTTTTTAAAAAATGG - Intergenic
1086314063 11:85571179-85571201 TATAAATTTTTGTTTAAAATTGG + Intronic
1086325034 11:85689987-85690009 TGTAAATGGTAGCTTTAAAAGGG - Intergenic
1086326869 11:85710373-85710395 TTTAAATAGGTTTTTAAAAAAGG + Intronic
1086978453 11:93165177-93165199 TATAAATAGATGTTTACAAATGG + Intronic
1087166622 11:95011791-95011813 TTAAAATTGCTTTTTAAAAAAGG + Intergenic
1087505132 11:99011165-99011187 TTTAAAAGTTTGTTAAAAGAAGG + Intergenic
1088377205 11:109154580-109154602 TTGAAATTCTTGTTTTAAAAAGG - Intergenic
1088559643 11:111100021-111100043 ATTAAACGGTTGGTTAATAAAGG + Intergenic
1088657487 11:112014500-112014522 TTTAAAAGGTGCTTTTAAAAAGG + Intronic
1088701445 11:112416362-112416384 TGTAAATCTTTGATTAAAAAAGG + Intergenic
1088930222 11:114343775-114343797 ATTAAATAATTTTTTAAAAATGG - Intergenic
1090683702 11:129090674-129090696 TTTAAATGTTCATTTTAAAATGG - Intronic
1091444654 12:536955-536977 TTTAAAAGCTTATTTAACAATGG - Intronic
1092097933 12:5859702-5859724 TTTAAATACTTTTTTAAAGATGG + Intronic
1092681298 12:10984010-10984032 TTTAAATGTTCATTTAGAAAGGG + Intronic
1092831853 12:12452094-12452116 TTTAAATTTTTATTTAAAAGAGG + Intronic
1093244563 12:16720630-16720652 TTGAGATGGTTTTATAAAAAAGG + Intergenic
1093312369 12:17605687-17605709 GGTGAATGGCTGTTTAAAAATGG - Intergenic
1093322232 12:17725791-17725813 TTTTAGTGATTGTTGAAAAATGG + Intergenic
1093435829 12:19133145-19133167 TTGATATGTTTGTTTAAAAAAGG + Intronic
1093472606 12:19519887-19519909 CTGGAATGGTTGTTTAATAAGGG + Exonic
1093682647 12:22020691-22020713 TTTAAAGGGAATTTTAAAAAGGG - Intergenic
1093901045 12:24632995-24633017 TTTTAATGTTGATTTAAAAACGG + Intergenic
1094675376 12:32614879-32614901 TTTAAAAGTTTGTGGAAAAATGG - Intronic
1094777739 12:33750920-33750942 TTTCAAGGGTTCTTTAACAAAGG + Intergenic
1095046154 12:37508873-37508895 TTTAAATGGTAGTTAAAAACAGG + Intergenic
1095193685 12:39287693-39287715 TTGAAATGGTTGTAAAAACAAGG + Intergenic
1095378531 12:41560469-41560491 TGTAAATGTTAGTTTCAAAATGG - Intronic
1095401715 12:41821813-41821835 TTTACATTGCTATTTAAAAATGG - Intergenic
1095759371 12:45811316-45811338 TTTAGATTATTGTTTAGAAAAGG + Intronic
1096289650 12:50330976-50330998 CTAAAATGGTAGTTTTAAAATGG - Intronic
1096321144 12:50614060-50614082 TTTCAATGTTTTGTTAAAAAGGG - Intronic
1096375272 12:51104198-51104220 TTTAAATGTTTCTTTAGAAATGG - Exonic
1097375153 12:58834660-58834682 TTTAAATGGTTCTTTAAAAATGG + Intergenic
1097787488 12:63777689-63777711 TTTGATTGATTGTTTAAAGAAGG + Intergenic
1097968239 12:65603913-65603935 TTAAAATGTGTTTTTAAAAATGG - Intergenic
1098131019 12:67349922-67349944 TTGAAATGGCTATTTTAAAAAGG + Intergenic
1098170984 12:67747164-67747186 TTTAAAAGATTGTGTAAAGATGG + Intergenic
1098257734 12:68634622-68634644 GTTAAGTGATTTTTTAAAAAAGG - Intronic
1098341694 12:69458240-69458262 TTTAAATTTTTGTTTACAGATGG + Intergenic
1098570931 12:71986483-71986505 TGTATATGATTTTTTAAAAATGG - Intronic
1098644735 12:72884509-72884531 TTTATATGGTTGTGTAAAACAGG + Intergenic
1098721016 12:73897621-73897643 TTTAAATGGATTTTTATAAAAGG + Intergenic
1099054758 12:77825216-77825238 TATAAAAGGTTGTTTATAAAAGG + Intergenic
1099116618 12:78634028-78634050 TTTAAATGATTATTTAAAGATGG - Intergenic
1099144060 12:79016666-79016688 TTGAAATGGATTTTTAAAACTGG + Intronic
1099200451 12:79670169-79670191 TTTACATGGCTTTTTAAAATGGG - Intronic
1099226681 12:79978495-79978517 TTTAAATGCTTACTTTAAAAAGG - Intergenic
1099311916 12:81036782-81036804 TATAAATGATTCTTTAAAATTGG + Intronic
1099552089 12:84058608-84058630 TTTAAATGGAAAATTAAAAAAGG - Intergenic
1099630928 12:85144445-85144467 TTTAATTGGTTGATCAAGAAAGG + Intronic
1100148423 12:91706189-91706211 TTTAAATGCGTCTTTAAAAATGG + Intergenic
1100200629 12:92294281-92294303 TTTAAATGGGTGGTTATAACAGG + Intergenic
1100572432 12:95855681-95855703 TTTAGATGGTTGTATACAACTGG + Intergenic
1101058742 12:100948589-100948611 GTAAAATGATTATTTAAAAAAGG + Intronic
1101475189 12:105039643-105039665 TTTCAATTTTTGTTTAAACAGGG - Intronic
1101619495 12:106371089-106371111 TTTAAATCCTGGTTTAAAGAGGG + Intronic
1101813117 12:108124711-108124733 TTTAAAAGTTTGATTAGAAAAGG + Intergenic
1101821317 12:108186189-108186211 TTTAAAAGTCTATTTAAAAAGGG - Intronic
1102965617 12:117123209-117123231 TTTAAATTTTTTTTTAAAAATGG + Intergenic
1103090253 12:118092963-118092985 TTTAAATGGTTGGAAAAAAAAGG - Intronic
1103244645 12:119446203-119446225 TTTAACTAGTTGTTTAGATATGG - Intronic
1103333536 12:120171725-120171747 TTTAATTTATTTTTTAAAAAAGG - Intronic
1105042632 12:132972441-132972463 TGTCAATGGTTTTGTAAAAAGGG - Intergenic
1105909693 13:24851528-24851550 TCTAAATATTTGATTAAAAAGGG + Exonic
1105928360 13:25029078-25029100 TTTAAAAACTTGTTTTAAAAAGG + Intergenic
1105942535 13:25162006-25162028 TTTAAAAACTTGTTTTAAAAAGG - Intronic
1106488854 13:30197576-30197598 TTTAAGTGCTGGTTTTAAAAAGG + Intergenic
1106613080 13:31301904-31301926 TTTAGGTGGTTATTAAAAAATGG - Intronic
1106877660 13:34091691-34091713 TTTACATGTTTTTTTAAACAGGG + Intergenic
1106993802 13:35457169-35457191 TTTAAATGGGTCTTAAAAATGGG - Intronic
1107519051 13:41161032-41161054 TTTAAATAGTTATTAAAAATGGG + Intergenic
1107565929 13:41604481-41604503 TTAAAATGGTGGATTAAAAACGG + Intronic
1107602670 13:42029438-42029460 TTATAATGCTTGTTTTAAAATGG + Intergenic
1107705240 13:43096663-43096685 GGTAATTGGTAGTTTAAAAATGG + Intronic
1107757645 13:43642175-43642197 TATAAGTAGTTCTTTAAAAAGGG + Intronic
1107874417 13:44777492-44777514 TTTAAGTGGCTTTTTAAAAATGG + Intergenic
1108051898 13:46452947-46452969 TATAAATGGTTTTTCAAAGAAGG + Intergenic
1108217084 13:48195915-48195937 TTTAGAATGTTGGTTAAAAACGG + Intergenic
1108392037 13:49956179-49956201 TTTAGATGGTTATTAAGAAATGG - Intergenic
1108663531 13:52607221-52607243 TTTAAAAAGATGTTTATAAATGG - Intergenic
1108836350 13:54554794-54554816 TTTAAATGGGCCTTTAATAATGG + Intergenic
1109327771 13:60890122-60890144 TTTAAATGGCTGTTTCCACATGG - Intergenic
1109604472 13:64674580-64674602 ATTAGGTGGTTGTTTAAAATCGG + Intergenic
1109618370 13:64867271-64867293 AATAAATAGTTCTTTAAAAATGG + Intergenic
1109672383 13:65626163-65626185 TCTAAATTAATGTTTAAAAAGGG + Intergenic
1110088707 13:71416687-71416709 TTTAAGTGGGAGTTTGAAAAGGG - Intergenic
1110313691 13:74080487-74080509 TTTAACTGTACGTTTAAAAATGG + Intronic
1110479029 13:75952133-75952155 TTTAGATGGTTTTCAAAAAACGG + Intergenic
1111219686 13:85188249-85188271 TTTTAATGGAAGTTTAATAAAGG + Intergenic
1111531834 13:89546841-89546863 TTTAAAGGGTAGTTTTATAATGG - Intergenic
1111958206 13:94781091-94781113 TTTAAATGGTGGTAGGAAAATGG + Intergenic
1112056814 13:95696561-95696583 TTAAAATTTTTTTTTAAAAAAGG - Intronic
1112114365 13:96336157-96336179 TTTAAATAGGTGCTTAAAAAAGG + Intronic
1112147313 13:96714702-96714724 TTAAAATTGTTTTTTAAAAAAGG + Intronic
1112229934 13:97579530-97579552 TTTACATGATTGTTTAAACATGG + Intergenic
1112418379 13:99225071-99225093 TTAAAATGGCTGTGTAAATAGGG + Intronic
1112588249 13:100738796-100738818 ATTAAAGTGTTCTTTAAAAAAGG + Intergenic
1112625229 13:101096326-101096348 TTTATCTGTTTGTTCAAAAATGG - Intronic
1112651568 13:101404690-101404712 TTTAAATGGCTGCTTACACATGG + Intronic
1112791999 13:103013535-103013557 TTGAAAAGATTTTTTAAAAAGGG + Intergenic
1112992351 13:105529156-105529178 TATTAATGGTTGTTTACAGAAGG - Intergenic
1113012198 13:105781416-105781438 TTTGAATAGGTGTTTAAATAAGG + Intergenic
1113247106 13:108409476-108409498 TTTAAAAGATTATTTAACAAGGG + Intergenic
1113335363 13:109371581-109371603 GTAAAATGTTTGCTTAAAAATGG - Intergenic
1115258965 14:31433377-31433399 TTTAAAATATTGTTAAAAAATGG - Intronic
1115301461 14:31890194-31890216 CTTAAGTGATTTTTTAAAAAAGG - Intergenic
1115466147 14:33716499-33716521 CTGAAATGTATGTTTAAAAATGG - Intronic
1115784000 14:36804069-36804091 TTTGTTTGTTTGTTTAAAAAAGG - Intronic
1116270818 14:42763470-42763492 TTTAAATGATGGCTTAAAAATGG + Intergenic
1116478418 14:45368028-45368050 TTTAAAGATTTTTTTAAAAATGG - Intergenic
1116746817 14:48830569-48830591 TTAAAATGATCTTTTAAAAAGGG - Intergenic
1116897379 14:50330355-50330377 TTTAAATGTTTATATTAAAAAGG + Exonic
1117421332 14:55549026-55549048 AAAAAATGGTTATTTAAAAATGG - Intergenic
1117537346 14:56714770-56714792 TGTAAGTAGTTGATTAAAAATGG + Intronic
1117611754 14:57490390-57490412 GTTAACTGGTTGTTTAAATTCGG - Intronic
1117691843 14:58315506-58315528 TTTAAATGGAGGTATGAAAAAGG - Intronic
1117737981 14:58786977-58786999 ATTAAATGGGTTTTTTAAAAAGG - Intergenic
1117815258 14:59591355-59591377 TTTGAATATTTTTTTAAAAAAGG + Intergenic
1118024222 14:61752486-61752508 CTGAAATGGATTTTTAAAAACGG + Intergenic
1118102192 14:62619124-62619146 CTTTGATGGTTGTTTAAGAAAGG + Intergenic
1118156215 14:63244642-63244664 ATTTGATGGGTGTTTAAAAATGG - Intronic
1118165896 14:63335893-63335915 TTGAAGTGGTAATTTAAAAATGG + Intergenic
1118579507 14:67280551-67280573 TTTAAAAAGTTGTTTAACTAAGG - Intronic
1118660216 14:68001084-68001106 TTTTAATAGTTTTTAAAAAATGG + Intronic
1118689311 14:68322913-68322935 CTTGAACGGTTGGTTAAAAAGGG + Intronic
1119193299 14:72699217-72699239 TTTAAAAATTTGTTTAGAAAGGG + Intronic
1119361312 14:74052670-74052692 TTTAAATGGTAGATTGGAAAAGG + Intronic
1119585190 14:75827431-75827453 TTTAAATGTTTATTTAAATAGGG + Intronic
1120238478 14:81921095-81921117 TATAAATGGGTATTAAAAAAAGG + Intergenic
1121735672 14:96216450-96216472 TTTAAATTTTTTTTTAAAGATGG - Intronic
1122237972 14:100343475-100343497 TTTTAATGATTGTTTTATAATGG - Intronic
1122583506 14:102787291-102787313 TTAAAATTGCTTTTTAAAAAGGG - Intronic
1122676139 14:103415284-103415306 TTTAAAGGCTTGATTTAAAATGG - Intronic
1123760370 15:23427370-23427392 TTTAAATTGTTTTGTAGAAATGG + Intergenic
1125090470 15:35785191-35785213 TTTAATTTAGTGTTTAAAAATGG + Intergenic
1125301186 15:38254266-38254288 TTTAAAAAGTTATTTCAAAAAGG - Intronic
1125439474 15:39686723-39686745 TTTAAAAGATTTTTTAAAACAGG + Intronic
1125572409 15:40730835-40730857 TTTTAATGTTTGTTTCAATATGG + Intronic
1126029209 15:44479577-44479599 TTTAAATTTTTGTGTAGAAATGG + Intronic
1126133850 15:45371339-45371361 TTTAAATTTTTGTTTAAAACTGG + Intronic
1126210250 15:46093506-46093528 TTTTAAGGATTGTTTGAAAATGG - Intergenic
1126288963 15:47049675-47049697 TTTAAATGATAGTTAAAAACAGG - Intergenic
1126809572 15:52387847-52387869 TTTAATTTGTTCTTCAAAAACGG + Exonic
1126899386 15:53297323-53297345 TTTAAATGCTGATTTATAAAAGG - Intergenic
1127198643 15:56618975-56618997 TTTAAAAATTTATTTAAAAAAGG - Intergenic
1127516035 15:59694237-59694259 TTTAAATATTTATTTAGAAATGG + Intergenic
1127616297 15:60689483-60689505 TTTAAATTTTAGTTTTAAAAAGG + Intronic
1127857647 15:62965921-62965943 TTTAAAGGGTTGTAAAAAGAAGG + Intergenic
1127967420 15:63932990-63933012 TTTCAATAATTGTTTAAAATGGG - Intronic
1129083129 15:73059358-73059380 TTCTAATGGTTCTTTAAAAAAGG - Intronic
1131002988 15:88953309-88953331 TGTAAATGCTTATTTTAAAAAGG + Intergenic
1131202869 15:90415388-90415410 TTTATTTAGTTTTTTAAAAATGG + Intronic
1131688079 15:94792928-94792950 TTTACATGGTTTTATAGAAAGGG - Intergenic
1132393501 15:101455903-101455925 TTCATATGGCTCTTTAAAAATGG + Intronic
1133667710 16:7985856-7985878 TTTAAATGATTGCATAAAGAAGG + Intergenic
1133934962 16:10261470-10261492 TTTATATCTTGGTTTAAAAAGGG + Intergenic
1134167116 16:11939773-11939795 TTTAAATGTTTCTTTCAAGATGG + Intronic
1134525524 16:14939685-14939707 TTTAAATGTTTCTTTCAAGATGG - Intronic
1134546880 16:15116693-15116715 TTTAAATGTTTCTTTCAAGATGG + Intronic
1134547365 16:15121177-15121199 TTTAAATGTTTCTTTCAAGATGG + Intronic
1134581596 16:15375951-15375973 TTTAAATGTTTCTTTCAAGATGG + Intronic
1134620854 16:15688002-15688024 TTTAAATGTTTTTGTAAAGATGG - Intronic
1134713109 16:16338171-16338193 TTTAAATGTTTCTTTCAAGATGG - Intergenic
1134720977 16:16381531-16381553 TTTAAATGTTTCTTTCAAGATGG - Intronic
1134946449 16:18330354-18330376 TTTAAATGTTTCTTTCAAGATGG + Intronic
1134953711 16:18370501-18370523 TTTAAATGTTTCTTTCAAGATGG + Intergenic
1135312508 16:21417219-21417241 TTTAAATGTTTCTTTCAAGATGG + Intronic
1135365456 16:21849684-21849706 TTTAAATGTTTCTTTCAAGATGG + Intronic
1135446383 16:22521664-22521686 TTTAAATGTTTCTTTCAAGATGG - Intronic
1135754500 16:25085618-25085640 TTTACATGATTGATTAAAAGGGG + Intergenic
1136151682 16:28355181-28355203 TTTAAATGTTTCTTTCAAGATGG + Intronic
1136167914 16:28469021-28469043 TTTAAATGTTTCTTTCAAGATGG + Intronic
1136195060 16:28645990-28646012 TTTAAATGTTTCTTTCAAGATGG - Intronic
1136211399 16:28760102-28760124 TTTAAATGTTTCTTTCAAGATGG - Intronic
1136256120 16:29040057-29040079 TTTAAATGTTTCTTTCAAGATGG - Intronic
1136309208 16:29396184-29396206 TTTAAATGTTTCTTTCAAGATGG + Intronic
1136322628 16:29497723-29497745 TTTAAATGTTTCTTTCAAGATGG + Intronic
1136364582 16:29803842-29803864 TTTAAATGCGGGTATAAAAAAGG + Intronic
1136371386 16:29838655-29838677 TTTAAAAGTTTTTGTAAAAATGG - Intronic
1136437308 16:30237695-30237717 TTTAAATGTTTCTTTCAAGATGG + Intronic
1136505651 16:30701324-30701346 TTTAAATTTTTCTATAAAAAGGG + Intronic
1136728463 16:32382403-32382425 TTTAAATGATCCTTCAAAAATGG - Intergenic
1137575726 16:49598841-49598863 TGTAAATGGTTGCTTCTAAAGGG + Intronic
1138065266 16:53934400-53934422 TTTACACTGTTGATTAAAAAGGG - Intronic
1138126063 16:54439554-54439576 TTTAAATTTTTTTTTAAAATAGG - Intergenic
1138562717 16:57811550-57811572 TTTAAATGTTTTTGTAGAAATGG - Intronic
1138754954 16:59472633-59472655 TTTAATTCATTGTATAAAAAAGG - Intergenic
1138764337 16:59583304-59583326 TTTAAAGGGTTGTTTCCTAATGG - Intergenic
1139585815 16:67902647-67902669 TTTAAATTTTTGTTTAAATGAGG - Intronic
1139765613 16:69226699-69226721 TTTAAATTGTTTTGTAAAGACGG + Intronic
1139856906 16:69988610-69988632 TTTAAATGTTTCTTTCAAGATGG + Intergenic
1140249008 16:73278100-73278122 TTTAAATGTTTGTGTCCAAAAGG + Intergenic
1140294997 16:73700645-73700667 TTTAAATAATTGATTGAAAATGG - Intergenic
1140365810 16:74379373-74379395 TTTAAATGTTTCTTTCAAGATGG - Intronic
1141743329 16:85909002-85909024 TTTAAAGGGAAGTTTAAAGAAGG + Exonic
1142654698 17:1383687-1383709 TTTAAAAAATTGTTTAAACAAGG - Intronic
1143688925 17:8543810-8543832 TATAATTGGTAGTTTAAATATGG - Intronic
1143887694 17:10077266-10077288 TTAAAATGGCTGATTGAAAACGG + Intronic
1143995344 17:11001837-11001859 TTTAAATGTTTGGGAAAAAAAGG + Intergenic
1144170938 17:12659273-12659295 TTTAAATCTTTGTTTAAATTAGG + Intergenic
1145725547 17:27118891-27118913 TTTATTTGATTTTTTAAAAAGGG + Intergenic
1146019414 17:29264361-29264383 TATATATAGTTATTTAAAAAAGG - Exonic
1146114504 17:30122943-30122965 TTTAAATTTTTTTTAAAAAAAGG - Intronic
1146218854 17:31000883-31000905 ATAAAATGGTTGTTAAAAATAGG - Intergenic
1146435834 17:32846648-32846670 TATAAATGTTTGTCTACAAAAGG - Intronic
1148132741 17:45271782-45271804 CTTAAAGTGTTTTTTAAAAATGG + Intronic
1148404022 17:47395916-47395938 TTTGAATAGTAATTTAAAAAAGG + Exonic
1149030288 17:52074867-52074889 TTTAAATGGTTGAAAAAAAAGGG + Intronic
1149031076 17:52083099-52083121 TTCCAATTGTAGTTTAAAAATGG - Intronic
1149472541 17:56929491-56929513 AATAACTGGTTGTTTAAGAAAGG + Intergenic
1149710632 17:58738926-58738948 TTTAAATGTATATTTACAAATGG - Intergenic
1149751619 17:59151339-59151361 TATCAATGTTTTTTTAAAAAAGG + Intronic
1149938488 17:60835963-60835985 TTTAAATGAATTTTAAAAAATGG + Intronic
1150342969 17:64383697-64383719 TTAAAATTGTTTTTTAAAAAGGG - Intronic
1150503904 17:65678939-65678961 TTTAAGTGATCCTTTAAAAATGG + Intronic
1150505620 17:65695616-65695638 GTTAAAAGGTTTTTTAATAAAGG + Intronic
1150837393 17:68576757-68576779 TTTAAATGGTTTTATCAAAGTGG + Intronic
1150841312 17:68609183-68609205 TTTAAATGCTTGTTTTATAATGG - Intergenic
1150860814 17:68798272-68798294 TTTATAGGGTTGTAAAAAAAAGG + Intergenic
1150994477 17:70300067-70300089 TTAAAATGTTTTTTTCAAAATGG + Intergenic
1151298704 17:73205292-73205314 TGTAAATGGTTGTTCTAAAGGGG - Intronic
1151409025 17:73908759-73908781 TTTAAATGGTTGGACAAACAAGG + Intergenic
1151409605 17:73913131-73913153 TTTTGATGGTTGTCTAAAACAGG + Intergenic
1151591850 17:75050097-75050119 TTTGAAATATTGTTTAAAAAGGG - Intronic
1152002094 17:77653324-77653346 TTTAAATACTTTTTAAAAAAAGG - Intergenic
1153055811 18:945295-945317 TTTAAAAGTTTTTTTAAAAAAGG - Intergenic
1153537190 18:6115163-6115185 TTTGAATGGTTTTTGAGAAATGG + Intronic
1153592432 18:6687595-6687617 TTTATATGGATGTATAATAAAGG + Intergenic
1153683245 18:7521260-7521282 TTTAAATGGTTGTCTTTTAATGG - Intergenic
1153859041 18:9180745-9180767 TCTAAATAGTTATTGAAAAATGG + Intronic
1154118387 18:11631885-11631907 TTTAAATGTTTCTTTCAAGATGG + Intergenic
1154277996 18:12979027-12979049 TTTGAAATGTTTTTTAAAAATGG + Intronic
1154511561 18:15109506-15109528 TTTAATTTATTTTTTAAAAATGG - Intergenic
1154977185 18:21470288-21470310 TTTAAATTTTTTTTTAAAAAAGG + Intronic
1155077883 18:22378403-22378425 TTTATTTGTTTGTTTAAAGATGG + Intergenic
1155196912 18:23484271-23484293 GTTCAAAGGTTTTTTAAAAAAGG - Intronic
1155328602 18:24691621-24691643 TTTAGATGGTTGTTAAGAAATGG + Intergenic
1155404951 18:25477649-25477671 TGTAGATGGTTTTTTAAATAAGG - Intergenic
1155405520 18:25482835-25482857 TTTAAAAGTTATTTTAAAAAGGG - Intergenic
1155732786 18:29181677-29181699 GATAAATGGTTGTTTAGAAGAGG - Intergenic
1155736434 18:29228338-29228360 TTTAAATGTGTGTTTAATATTGG + Intergenic
1155742271 18:29303144-29303166 CTTAAAGGTTTTTTTAAAAAGGG + Intergenic
1155833142 18:30543253-30543275 TTTAAATGTATGTTTAGTAAAGG + Intergenic
1155835238 18:30574150-30574172 TTCAGATGGTTCATTAAAAATGG + Intergenic
1155847395 18:30726220-30726242 TTTAAATATTTGTATAAAAAGGG + Intergenic
1155888011 18:31232027-31232049 TATAATTGGGTGTTTAACAATGG + Intergenic
1156028442 18:32684806-32684828 ATTAATTGGTGGTTTAAAAAAGG - Intronic
1156071582 18:33218094-33218116 TTTAAATGTTTGTCTTATAATGG - Intronic
1156141241 18:34113914-34113936 TTTAAATAGATGTTCATAAATGG + Intronic
1156684326 18:39626771-39626793 TTTTAAAACTTGTTTAAAAATGG + Intergenic
1156693536 18:39737579-39737601 CTTAAAAGGTTTTTTATAAAGGG + Intergenic
1156765206 18:40645056-40645078 TTGAAAAAGTAGTTTAAAAAAGG - Intergenic
1156882623 18:42098996-42099018 TTAAAATGGTTGCCAAAAAAAGG - Intergenic
1157183106 18:45515172-45515194 TTCAAATGAATGATTAAAAATGG + Intronic
1157266886 18:46232359-46232381 TTTAAATAATTTTTTAAAAGGGG - Intronic
1157371008 18:47111905-47111927 TTTAATTGGCTGTTTACAGAAGG - Intronic
1157769577 18:50334015-50334037 TTGAAATAGTTGTGTCAAAAAGG + Intergenic
1157852221 18:51066025-51066047 TTTTAATGACTGTATAAAAAAGG - Intronic
1158192665 18:54848067-54848089 TTCAAATCGTTGTTCAAATAAGG - Intronic
1158224338 18:55184958-55184980 TTTATGGGGTTATTTAAAAAGGG + Intergenic
1158308663 18:56135172-56135194 TTTAAAAGGCACTTTAAAAATGG + Intergenic
1158644655 18:59235016-59235038 TTTAAATATTTATTTAAACAAGG - Intergenic
1158971410 18:62671005-62671027 TTTTAAAAGTTATTTAAAAATGG + Intergenic
1159347363 18:67224452-67224474 TGTAAAGGGTTGTTTAGCAAAGG - Intergenic
1159440962 18:68479359-68479381 TTTAAATGGTCGTATAAAACAGG - Intergenic
1159448472 18:68569327-68569349 TTATAATGGTTGTTTATAATGGG + Intergenic
1159676015 18:71285190-71285212 TTGAAATGTTTGTCTAATAAAGG - Intergenic
1159704614 18:71672069-71672091 ATTAAAGGGTTGTTCCAAAATGG - Intergenic
1159737708 18:72122325-72122347 GTGAAATGAATGTTTAAAAAGGG + Intergenic
1160358565 18:78249678-78249700 TTTAAATGGCTGCTTAAGAATGG - Intergenic
1161620812 19:5296068-5296090 TGGAAATGTTTGTTTAGAAAAGG - Intronic
1161753905 19:6117473-6117495 TTTAAATTTTTTTTTAGAAATGG - Intronic
1162945967 19:14043735-14043757 TTTAAATGCTAGTATCAAAAGGG + Intronic
1164675730 19:30099579-30099601 TTTAAACTTTTTTTTAAAAATGG - Intergenic
1164875504 19:31683127-31683149 TTGAAAGGGGTGTTTAAAAATGG - Intergenic
1165240308 19:34461560-34461582 TTCAAATGCTAGCTTAAAAATGG + Intronic
1165944687 19:39434981-39435003 TTTAAATGCTTGCTTGTAAAAGG - Intronic
1168325087 19:55534533-55534555 TTTAAATGTTTTTTTTAAGATGG - Intronic
1168481809 19:56726393-56726415 TTTAAATTTTTGAATAAAAATGG + Intergenic
1168672604 19:58252362-58252384 AATGAATGGTTGTTTAAAGAGGG - Intronic
925784078 2:7411633-7411655 TTAAAATATTTATTTAAAAAAGG - Intergenic
925810533 2:7695780-7695802 TTTAAAAGGTAGATTTAAAATGG - Intergenic
925945883 2:8863316-8863338 TTTAATTTGTCATTTAAAAAAGG + Intronic
926260304 2:11254169-11254191 TTTTGATGGTTGTTTACAATGGG - Intronic
926293038 2:11545543-11545565 TTTAAGTTGCTTTTTAAAAATGG - Intronic
927031664 2:19126278-19126300 TTTAAATGGTGCTCTTAAAATGG + Intergenic
927837810 2:26414904-26414926 TTGAGATGGTTGTTGAAAATGGG - Intronic
928600921 2:32902812-32902834 TTTAAATGTAAATTTAAAAATGG - Intergenic
929472774 2:42212381-42212403 TTTAAATGGCTATTAAAATATGG - Intronic
930421233 2:51155266-51155288 TATAAATTGTTGTTTCATAAAGG + Intergenic
930422669 2:51174219-51174241 TTTAAATAGATATTTAAAAGGGG - Intergenic
930482697 2:51969238-51969260 CTTAAATGGTTTTATAAGAAAGG - Intergenic
930697893 2:54430435-54430457 TTAATTTGGTTCTTTAAAAAAGG + Intergenic
930756992 2:54985467-54985489 TTGAAATTGTAGTTTGAAAATGG - Intronic
930760958 2:55035497-55035519 TTTAAATGCTTTTAGAAAAAAGG + Intronic
931832686 2:66068846-66068868 TTTTCATGGTTTTTTTAAAAAGG + Intergenic
932205933 2:69882762-69882784 TTAAAATAATTTTTTAAAAAGGG + Intergenic
932767232 2:74478647-74478669 TTTAAAAAGATTTTTAAAAAGGG + Intronic
933171320 2:79129088-79129110 TTTAGATGATTATTAAAAAATGG - Intergenic
933527871 2:83466623-83466645 TTTAAATGGTCCTGTAAAGAAGG - Intergenic
934458625 2:94197322-94197344 TTTAAATTGGTGTTAAGAAAGGG - Intergenic
935136952 2:100313818-100313840 TATAAATGGATATTTATAAATGG + Intronic
935205006 2:100889838-100889860 TTTAATTGACTTTTTAAAAATGG + Intronic
935550975 2:104453706-104453728 TTTGAATGCTTGTTGAATAAAGG + Intergenic
935842345 2:107127215-107127237 TTTAAATACTAGTCTAAAAATGG + Intergenic
935874376 2:107490083-107490105 TTTAAAAGCTTATTTAAAATAGG - Intergenic
935930475 2:108118782-108118804 TTTTAATGGTTCCTCAAAAAAGG - Intergenic
936032033 2:109080163-109080185 TTTTAATGGTTAATCAAAAATGG + Intergenic
936957064 2:118033200-118033222 ATTGACTCGTTGTTTAAAAAGGG + Intergenic
937490984 2:122367100-122367122 TCTAAAAGGATGTTTTAAAAAGG - Intergenic
937805035 2:126129495-126129517 TTAAAATGGTATTATAAAAAAGG - Intergenic
937997344 2:127704769-127704791 TTTCAATGGTTGCTTAGAAAAGG - Exonic
938225901 2:129616154-129616176 TTTAGGTGGTTTTTTAACAAAGG - Intergenic
938260233 2:129890610-129890632 ATTAAGTCCTTGTTTAAAAAAGG + Intergenic
938508747 2:131916851-131916873 TTTTAATGTATGTTTAAACAAGG - Intergenic
938729116 2:134132238-134132260 TTTTAATGGTTTTCTAAAAAGGG - Intronic
938889560 2:135690022-135690044 TTTTAAAGGTTCTTAAAAAAAGG - Intronic
938934130 2:136114035-136114057 TTCAAATGGAAGTTTAGAAATGG - Intergenic
939160243 2:138579458-138579480 GTGAAATGGTCATTTAAAAATGG - Intergenic
939237472 2:139515705-139515727 TTTAAATTGCTGTTTAAGAAAGG + Intergenic
939242737 2:139582216-139582238 TTTAAATGCTTTTATTAAAATGG - Intergenic
939737213 2:145862506-145862528 TTTAAATTGTTGTGAGAAAATGG - Intergenic
939779385 2:146426430-146426452 TATATTTGGTTGTTTAAAAAAGG + Intergenic
939930067 2:148222956-148222978 TTTTAATGGTGGATTATAAAGGG + Intronic
939931184 2:148235772-148235794 TTAAAATAGTTTTCTAAAAAAGG + Intronic
940078245 2:149768599-149768621 TTTAAATCATTTTTTAAAAAGGG + Intergenic
940491454 2:154367066-154367088 TTTCAATTTTTTTTTAAAAAAGG - Intronic
940598924 2:155832253-155832275 TTTAAAATGCTGTTTATAAATGG + Intergenic
940686971 2:156864030-156864052 TGTAAAGAGTTGGTTAAAAAAGG + Intergenic
941047965 2:160697731-160697753 TTTAAATGGTTGGTAAAATTTGG - Intergenic
941096123 2:161240128-161240150 TTTAAATTGATTTTTTAAAAAGG - Intergenic
941550990 2:166914726-166914748 TTTTAAACATTGTTTAAAAATGG + Intronic
941562690 2:167068618-167068640 GTTAAAAGTTAGTTTAAAAAAGG - Intronic
942143741 2:173004369-173004391 TTTAAATGCAGATTTAAAAAAGG - Intronic
942477282 2:176340820-176340842 TTTAAATTTTTATTTAAATAAGG - Intergenic
942795229 2:179810205-179810227 TTTAAGTGATTGTTTTATAAAGG + Intronic
942941204 2:181619887-181619909 ATTAAATGGTGGTTTTAAGATGG + Intronic
942985745 2:182139362-182139384 TTTAAATGTTTTTCTAAATACGG - Intergenic
943055965 2:182980194-182980216 TTTCTATGGTCATTTAAAAAGGG - Intronic
943079442 2:183240524-183240546 TTTCTGTGCTTGTTTAAAAATGG - Intergenic
943205077 2:184884540-184884562 TTTACAGTGTAGTTTAAAAAGGG - Intronic
943616077 2:190094244-190094266 TTTTAAAGGTTTTTTTAAAAAGG + Intronic
943616078 2:190094245-190094267 TTTAAAGGTTTTTTTAAAAAGGG + Intronic
943689175 2:190851409-190851431 TTAACTTGGTTATTTAAAAATGG + Intergenic
943936744 2:193928370-193928392 TTTAATTATTTGTATAAAAATGG + Intergenic
944298664 2:198096669-198096691 TTAAATTTGTTGTTAAAAAAAGG + Intronic
944515315 2:200507320-200507342 TTGAAATGACTGTTTAAACATGG + Intronic
944699555 2:202234553-202234575 TTTAAAGGATTATTTAATAATGG + Intronic
944836205 2:203582394-203582416 TTTAAGTGATTATATAAAAAGGG + Intergenic
945013825 2:205493419-205493441 TTTCAATGGTTTTCTCAAAAAGG - Intronic
945061006 2:205908855-205908877 TTTTATGGTTTGTTTAAAAATGG + Intergenic
945693184 2:213068026-213068048 TTTAAATGGTGATTTAGAAATGG - Intronic
946779852 2:223182860-223182882 TTAAGATGGTTGTTAAAACATGG + Intronic
947330707 2:229026375-229026397 TTTTAATTGGGGTTTAAAAAAGG - Intronic
947429886 2:230018035-230018057 TTTAAATTTTTTTTAAAAAATGG + Intergenic
948094612 2:235323900-235323922 TGTTCATGGTTTTTTAAAAATGG - Intergenic
948101753 2:235380493-235380515 TTTAATTTTTTATTTAAAAAAGG + Intergenic
1169099048 20:2929844-2929866 TTTAAGTAGTTGATTAAAAGAGG + Intronic
1169511100 20:6264910-6264932 TTTAAATGTTCTTTTTAAAATGG - Intergenic
1169667393 20:8052974-8052996 ATTAAATGGTTGTTTTTTAATGG - Intergenic
1169985493 20:11438845-11438867 TATAAATGCCTGTATAAAAATGG - Intergenic
1169996716 20:11565392-11565414 TAAAAATGCTTGTTTAAAATTGG + Intergenic
1171540710 20:25952471-25952493 TTTAAATGGTAGTTAAAAACAGG + Intergenic
1171800357 20:29607861-29607883 TTTAAACGGTAGTTAAAAACAGG - Intergenic
1171843739 20:30248846-30248868 TTTAAACGGTAGTTAAAAACAGG + Intergenic
1172560130 20:35880566-35880588 TTAAAAATGTTGTTAAAAAATGG + Intronic
1173071429 20:39771607-39771629 TTAAATTGGCTATTTAAAAATGG - Intergenic
1174921569 20:54708488-54708510 TTCAAATGACTGTTTAACAAGGG + Intergenic
1175426278 20:58869332-58869354 TTTAAATGTCTGTTCCAAAATGG + Intronic
1176704663 21:10104552-10104574 TTCAATTGATTGTTTAAACAAGG + Intergenic
1176784744 21:13241688-13241710 TTTTAATGTATGTTTAAACAAGG + Intergenic
1176948323 21:15011496-15011518 TATAAATTTTTTTTTAAAAAAGG - Intronic
1177053928 21:16275825-16275847 TATAAATGGATGTTTAAGGAGGG - Intergenic
1177245720 21:18520498-18520520 GTTAAATGAGTGTTTTAAAAAGG + Intergenic
1177592933 21:23195919-23195941 TTAACAAGGTTATTTAAAAATGG + Intergenic
1178046495 21:28700319-28700341 TTTTGATGACTGTTTAAAAATGG - Intergenic
1178121847 21:29477294-29477316 TTTTTATGGTTCTTTAGAAATGG + Intronic
1178250965 21:31003115-31003137 TTATAATGGTTGTTTTTAAAGGG - Intergenic
1178292462 21:31380612-31380634 TTTAAATGGATGATTCGAAAGGG + Intronic
1178548985 21:33519241-33519263 TTTAAATGGTCATATAAAAGAGG + Intronic
1178757012 21:35360964-35360986 TTTAAATGGTTGGAAAAAATCGG + Intronic
1178879431 21:36436848-36436870 TTTAAGTTGTGGCTTAAAAATGG + Intergenic
1179680809 21:43020101-43020123 TTTAAATGTTTTTGTAAAGACGG + Intronic
1180130237 21:45822435-45822457 TAAAAATGATTTTTTAAAAATGG + Intronic
1180615941 22:17127272-17127294 TTTAAATGTTTGTGTTACAAAGG + Intronic
1180703263 22:17793296-17793318 TTTCAGTGGTTGTTTGGAAAGGG + Intronic
1181987637 22:26811644-26811666 TTAAAATGATTTGTTAAAAAAGG + Intergenic
1182258731 22:29057155-29057177 TTTAAAACATTTTTTAAAAATGG - Exonic
1182402493 22:30090709-30090731 TATAAATGATTATTCAAAAATGG - Intronic
1183295566 22:37027413-37027435 TCAAAATGATCGTTTAAAAATGG + Intronic
1184471593 22:44699106-44699128 TTTAAAGAGATCTTTAAAAAAGG - Intronic
1185010676 22:48311382-48311404 TATAAATGATTGTGTAAAACAGG + Intergenic
949189462 3:1234182-1234204 TTTAAAAAGTTGTTTCAAGAAGG - Intronic
949617746 3:5773317-5773339 TTTAAATGTGTGTATTAAAATGG - Intergenic
949750323 3:7345069-7345091 TTTAAATGTTTTTTAAAAAAAGG + Intronic
950054890 3:10016565-10016587 CTTAAATGGTTATTATAAAACGG + Intergenic
950827123 3:15835499-15835521 TCTAAATGTTTGTTTAGAGATGG - Intronic
951068941 3:18302878-18302900 TTTACATGTTAGTTTCAAAATGG - Intronic
951246085 3:20343199-20343221 TTTAAATTTTTTCTTAAAAATGG - Intergenic
951411809 3:22374944-22374966 TTTTAATGTTTGTTTAGGAAAGG + Intergenic
951476204 3:23108952-23108974 TTTACATATTTATTTAAAAATGG - Intergenic
951495257 3:23318111-23318133 GTTTAATGGTTTTTTTAAAAAGG + Intronic
951603480 3:24402953-24402975 TTTAAATATTTCTTTAAATAAGG - Intronic
951738128 3:25890319-25890341 TTTAACTAGTTGTTTACATAGGG - Intergenic
951779071 3:26342371-26342393 TTTAAATTATTGTTTAAAGGGGG + Intergenic
951785590 3:26415223-26415245 TTTTGATGTTTGTTTAAAAAGGG - Intergenic
952079028 3:29734541-29734563 TTAAAAATGTTTTTTAAAAAGGG + Intronic
952115183 3:30170552-30170574 TCTAAATGGTTTTGTAAAATTGG - Intergenic
952148486 3:30560306-30560328 TTTACATGGTAGATTAAAGATGG + Intergenic
952704613 3:36364878-36364900 TTTAGATGGTTGTTACAAAATGG + Intergenic
952914207 3:38220226-38220248 TTCAAATAATTGTTTGAAAATGG + Intronic
954005486 3:47587244-47587266 TTTAAAGGGTTTTTTAAAGAGGG + Exonic
954169628 3:48790665-48790687 TTTAAGTGGTTATTTTAAAATGG - Intronic
955183897 3:56696771-56696793 CTTAAACTGTTTTTTAAAAAAGG + Intergenic
955264678 3:57430233-57430255 TTTAAACTGTTTTTTTAAAAAGG - Intronic
955307756 3:57851299-57851321 TTTATACGGTTCTTTAAATATGG - Intronic
955530688 3:59869794-59869816 ATTAAATGGTATTTTAAAAATGG - Intronic
955561305 3:60193884-60193906 TTGATATGGGTGTTAAAAAATGG + Intronic
955768708 3:62369735-62369757 TTTACATGGCTGTATAAAGATGG + Exonic
955849235 3:63202322-63202344 TTAAAGTGGTGTTTTAAAAATGG + Intergenic
955927154 3:64018356-64018378 TTTAAAGTGTTGTTTAAAAAAGG - Intronic
956091790 3:65675394-65675416 TATAAATGGTGATTTAAAAACGG + Intronic
956147221 3:66202725-66202747 TTAAAATGTTTTTTTTAAAATGG - Intronic
956268131 3:67421237-67421259 TTTAAATGGGTCTTTAAAATGGG - Intronic
956315599 3:67932441-67932463 TTTAAATGCTTGTGTTTAAAAGG + Intergenic
956684177 3:71809167-71809189 TTTAAAAGGTAAGTTAAAAAGGG + Intergenic
956964929 3:74447856-74447878 TTTATCTGCTTATTTAAAAATGG - Intronic
957137371 3:76306763-76306785 TTTAAATGTTTGTTCAATGAAGG + Intronic
957385697 3:79493593-79493615 TTTAAAAGTTTGTTGAAAAAAGG + Intronic
957389569 3:79546704-79546726 TGTAACTGGTTATTTAACAATGG + Intronic
957494654 3:80976545-80976567 TTTAAATATTTTTGTAAAAATGG - Intergenic
957766991 3:84638365-84638387 TTTAAATGGTTGTCATAAGAAGG - Intergenic
957894471 3:86403408-86403430 TGTAAAAGTTTGTTTGAAAATGG - Intergenic
958117853 3:89245026-89245048 TTTAAATGTTTCTTCAAGAATGG - Intronic
958559182 3:95721330-95721352 TTTAAATGTTTATCTAAAAGGGG + Intergenic
958576502 3:95955728-95955750 TTTAAAGAGTTGTTTTAGAATGG + Intergenic
958698214 3:97554108-97554130 TTTCAATAGTTGCTTATAAATGG + Intronic
958964774 3:100547056-100547078 GTTAATTGGCTGTTTATAAAAGG - Intronic
959020500 3:101183099-101183121 TTCAGATGGTTATTTTAAAATGG + Intergenic
959040508 3:101417118-101417140 TTTAAATGAATTTTTAAAACAGG - Intronic
959087363 3:101865324-101865346 ATAAAATGATTTTTTAAAAAAGG - Intergenic
959089720 3:101889019-101889041 ATTAGAAGGTTGTTTAAAATTGG - Intergenic
959588037 3:108044118-108044140 TTAAAATGGGTATTCAAAAATGG - Intronic
959916826 3:111825759-111825781 CTTAAAGGGTTATTTAAAAGAGG - Intronic
960305738 3:116058476-116058498 ATTAAAAAGTTTTTTAAAAATGG + Intronic
960644868 3:119868520-119868542 TGTATGTGATTGTTTAAAAATGG - Intronic
960821796 3:121741842-121741864 TTTAAAAACTTTTTTAAAAATGG - Intronic
961255590 3:125548546-125548568 TTTAAAAGGTTTTATAAAAAGGG + Intronic
961344359 3:126253205-126253227 TTTAAAAGGCTTTTTATAAAAGG + Intergenic
961773921 3:129270296-129270318 TTTGGATGATTGTTTAAAAATGG - Intronic
962054384 3:131854545-131854567 TTTAAAAAATTGGTTAAAAATGG + Intronic
962165095 3:133039490-133039512 TTTAAATCATACTTTAAAAAGGG + Intronic
962486607 3:135849485-135849507 TTTAAAATGATGTTTAAAATGGG + Intergenic
962924903 3:139983616-139983638 TTTAAATATTTAATTAAAAATGG - Intronic
963644308 3:147894841-147894863 TTTAAATTTTTTTGTAAAAATGG - Intergenic
963826101 3:149955895-149955917 TTTCAAGCCTTGTTTAAAAATGG + Intronic
963886750 3:150591461-150591483 TATAAAAGTTTGATTAAAAATGG + Intronic
964007127 3:151844711-151844733 TTTAAATAATTTTTTAAAAAAGG - Intergenic
964504374 3:157382492-157382514 TTTAAATTGTTATTTATTAATGG - Intronic
964742272 3:159978984-159979006 TCTAAGTGTTTTTTTAAAAAAGG + Intergenic
964837481 3:160955317-160955339 TTTAAATTATTTTTTAAAATTGG + Intronic
964854815 3:161135526-161135548 TTCCAATGGTGGTTGAAAAATGG - Intronic
964869499 3:161297777-161297799 TTTAAGTGGTTATATAAAATGGG - Intergenic
965278908 3:166723337-166723359 TTAAAATGATTTTTTAAAGAGGG - Intergenic
965307634 3:167086649-167086671 TTAAAATGGTGGCTTAAAATAGG + Intergenic
965450971 3:168837362-168837384 TTTAAATGGCTGATTGATAATGG + Intergenic
965457024 3:168914176-168914198 TTTATTTATTTGTTTAAAAAAGG - Intergenic
965481791 3:169227731-169227753 ATAAAATGCTTGTTTTAAAAAGG + Intronic
965515193 3:169613898-169613920 TTTAAAGGGTATTTTAACAAGGG - Intronic
965843807 3:172938399-172938421 TTTAGATGGTTATTAAGAAATGG + Intronic
966130425 3:176631909-176631931 TTTAAATGATTTTTTAAATCAGG + Intergenic
967115937 3:186338649-186338671 TTTTAATTCTTTTTTAAAAAGGG + Intronic
967653189 3:192012207-192012229 TTTTGATGCTTTTTTAAAAAAGG - Intergenic
967746415 3:193060747-193060769 TTTAAAAGGCTTTTTAAAAATGG - Intergenic
967832705 3:193934200-193934222 TTTAAAAAGGTGTTTTAAAAAGG + Intergenic
969628102 4:8318343-8318365 TTTAAAAGGTTGTTAAAAGAAGG + Intergenic
970236390 4:13962620-13962642 TTTAAATGGCTATTCAAAGAAGG - Intergenic
970272284 4:14359865-14359887 TTTAACAGGATGTTTGAAAAGGG + Intergenic
970427422 4:15958372-15958394 TTTAAAATGTTGGTGAAAAATGG + Intergenic
971437119 4:26639368-26639390 TTTAAAGGCTGCTTTAAAAAAGG - Intronic
971574910 4:28260185-28260207 TGTAAATCTTTGTTTAAACATGG + Intergenic
971584260 4:28385005-28385027 TTCAAATTAGTGTTTAAAAATGG - Intronic
971585359 4:28399176-28399198 TTTTAATACTTGTTTACAAAGGG + Intronic
971940499 4:33208665-33208687 TTTAAATAGTTGATTAATATAGG - Intergenic
972221258 4:36958226-36958248 TTTAAATGGTATTTTAACAAAGG - Intergenic
973056229 4:45662245-45662267 TATAAAACGTTTTTTAAAAAAGG - Intergenic
973256533 4:48118900-48118922 TTGAAAGGGTTATTTATAAAGGG + Intronic
973829883 4:54747892-54747914 AATAAATGGTTGCTTAAGAAAGG - Intergenic
973952915 4:56035830-56035852 TTAAAATGGGAGATTAAAAATGG - Intergenic
974059605 4:57019512-57019534 GTTAAAAGTTTTTTTAAAAATGG - Intronic
974060943 4:57034968-57034990 TTGAAATAGTTACTTAAAAATGG + Intronic
974403542 4:61436062-61436084 TTTAAATGGTTTTGTAAACATGG - Intronic
974449957 4:62041686-62041708 ATTAAACCTTTGTTTAAAAATGG + Intronic
974496052 4:62629162-62629184 TATAAGTGTTTGTTGAAAAATGG + Intergenic
974718474 4:65703299-65703321 TTTAAATGGATGTATTTAAATGG - Intergenic
974754116 4:66181505-66181527 TTTAAATGGATGTGTTAAGATGG + Intergenic
975589611 4:75987126-75987148 TTTAAAGGATTTTTTGAAAAAGG - Intronic
975768961 4:77700091-77700113 TTTAAAGAGTTGCTTAAACAGGG - Intergenic
976336019 4:83887748-83887770 ATAAAGTGGTTTTTTAAAAAAGG - Intergenic
976550176 4:86385322-86385344 TTTAAATGGTAAATTAACAATGG - Intronic
976561365 4:86505307-86505329 TTTAAATTATTTTTTAAAAATGG + Intronic
976656141 4:87490668-87490690 TTGAAATTTTTGCTTAAAAAAGG - Intronic
976761656 4:88555584-88555606 TATAAAAGGTTCTTTTAAAAAGG + Intronic
976969530 4:91088689-91088711 ATAAAAAGCTTGTTTAAAAAGGG + Intronic
977085193 4:92587913-92587935 TCTAAATGAGTCTTTAAAAAAGG - Intronic
977099905 4:92798060-92798082 TTTAAATGTTTCTTTAAAAAAGG + Intronic
977186710 4:93947714-93947736 TTTAAATGGATGTTTAAGAGAGG + Intergenic
977392761 4:96432741-96432763 TTTAAATGGTTCTATCCAAATGG + Intergenic
977664869 4:99634755-99634777 TTTAAACGGTTTTTTTTAAAAGG - Intergenic
977959510 4:103070176-103070198 TTTAAATGGTCTTTTAGAAATGG - Intronic
978051652 4:104207934-104207956 ATTTCATGGTTTTTTAAAAAAGG - Intergenic
978080829 4:104589338-104589360 TTTAAAGTGTTCTTTAAGAAAGG + Intergenic
978487895 4:109276768-109276790 CTAACAAGGTTGTTTAAAAATGG - Intronic
978500742 4:109407630-109407652 TTTAAAAGATTGTTTAGAAAGGG + Intergenic
978949581 4:114541800-114541822 TTAAAATAGGTGTTTACAAAGGG + Intergenic
978950959 4:114558742-114558764 AATAACTGGTTGTTTAAAAGAGG - Intergenic
978968389 4:114771076-114771098 TATAAAAGGTTTTTTAAAAGTGG + Intergenic
979425187 4:120555089-120555111 TTAAAGTGCTTGTTTGAAAATGG + Intergenic
979861079 4:125694756-125694778 TTTAGATGTATGTTTAGAAACGG + Intergenic
979927054 4:126581002-126581024 TTAAAATGGTTGGTTAGTAAAGG + Intergenic
979969659 4:127118591-127118613 TTTTAATGGTGTTTGAAAAATGG - Intergenic
980100575 4:128537938-128537960 TAAAAATAGATGTTTAAAAATGG - Intergenic
980254962 4:130367476-130367498 TTTATATTGATGATTAAAAATGG - Intergenic
980376879 4:131961002-131961024 TTCAATTGATTGTTTAAACAAGG + Intergenic
980573968 4:134661910-134661932 TATATATAGTAGTTTAAAAATGG - Intergenic
980579156 4:134727140-134727162 TTTAATTGGTTATTTATGAAAGG - Intergenic
980673964 4:136050177-136050199 TTTAACTAGTTGATTAAAAGAGG + Intergenic
981172446 4:141640566-141640588 TTTTTTTGTTTGTTTAAAAAAGG - Intronic
981250712 4:142597828-142597850 TGTAAATTTTTGTTTATAAAAGG - Intronic
981298591 4:143161254-143161276 TATAAATTGTTGTTAAAATACGG + Intergenic
981320456 4:143385965-143385987 TTTAAATTTTTGTATAAACAGGG - Intronic
981484563 4:145271609-145271631 TTTTAATGGTTGTGTAAATCAGG - Intergenic
981619007 4:146672832-146672854 TTTAAAGGATGGTTTAAAACAGG + Intergenic
981955756 4:150471282-150471304 TTTCAATGGTTGTATAAGGATGG - Intronic
981969163 4:150645552-150645574 TTTAAATGGATTTTGAAATATGG - Intronic
982168552 4:152638884-152638906 GTTAAATGATTGTTTTAAAAGGG - Intronic
982894072 4:160894626-160894648 TTTAAATCATTTTTTAAAGATGG - Intergenic
982894192 4:160896016-160896038 TTTAAATCATTTTTTAAAGATGG - Intergenic
983129162 4:163993776-163993798 ATTAAATCCTTTTTTAAAAAGGG + Intronic
983136134 4:164083035-164083057 TATAAATGGTGGTTTAGACAGGG + Intronic
983171090 4:164537270-164537292 TTTGAAGGGTTGTGAAAAAATGG + Intergenic
983315147 4:166122623-166122645 TTGAAATAGTTGTTAAAAGATGG - Intergenic
983435089 4:167703948-167703970 TTTATATGTATGATTAAAAAAGG + Intergenic
983867070 4:172780344-172780366 TTTAAATTGTTGGTTAAATTGGG + Intronic
984126002 4:175811708-175811730 TTTTAAAGATTGTTTTAAAAAGG + Intronic
984431295 4:179652765-179652787 GTTAAATGGAGGTTTAAATAAGG - Intergenic
984921444 4:184767667-184767689 TTTTAATGGTTCTTTTTAAAAGG - Intronic
984947569 4:184982031-184982053 TTTAAATTATTTTTTAGAAATGG - Intergenic
985125946 4:186694588-186694610 TTTAAAGGGTGGTTGAATAATGG - Intronic
985898590 5:2766745-2766767 TTTACATGTTTTTTTAAACAAGG - Intergenic
986079207 5:4372192-4372214 TATAAATTATTGTCTAAAAATGG - Intergenic
986611052 5:9567612-9567634 TTTTAAATGTTGTTAAAAAATGG - Intergenic
986787101 5:11124622-11124644 TTTAAAAGGTTGTTGAAAGAAGG - Intronic
987329217 5:16840828-16840850 TTTAAAATTTTTTTTAAAAAAGG + Intronic
987377482 5:17249679-17249701 TCTAAATTGAAGTTTAAAAAAGG - Intronic
987445435 5:18012238-18012260 TTTATAGGTTTCTTTAAAAATGG + Intergenic
987535043 5:19174905-19174927 TTCATCTGGTTTTTTAAAAATGG + Intergenic
987577279 5:19746118-19746140 TTTAAAAAGTAGTTTAAAAATGG - Intronic
987746410 5:21979072-21979094 TTAAAAAGGCTGTGTAAAAATGG - Intronic
987862255 5:23503918-23503940 TAGATCTGGTTGTTTAAAAATGG + Intergenic
987982826 5:25109713-25109735 TTTAAATGGTTTATTTTAAATGG + Intergenic
988055583 5:26090733-26090755 ATTAAATACTTGTTTAAATATGG - Intergenic
988165086 5:27577971-27577993 ATTAAATTGCTGTTTAAAGAAGG - Intergenic
988321283 5:29700689-29700711 TTTAAAAGGTTTTTCAAGAAAGG - Intergenic
988633346 5:32954996-32955018 TTCAAATTGTTGTTAATAAATGG + Intergenic
988837188 5:35044904-35044926 TTTAAATGTTTTCTTAAAATAGG + Intronic
989019589 5:36987018-36987040 TTTAAATACTTGTGTACAAAGGG - Intronic
989272271 5:39547344-39547366 TGGAAATGGTTGTCTAAAATGGG - Intergenic
989443588 5:41502624-41502646 TTTAAATGGGTGTTCAATACAGG - Intronic
989446784 5:41539293-41539315 TGAAAAATGTTGTTTAAAAATGG - Intergenic
989478572 5:41902461-41902483 TCTAAATGTTTATTTTAAAAAGG + Intergenic
990060851 5:51646492-51646514 TGTAAATGCTTTTTTAAAACAGG + Intergenic
990118014 5:52413290-52413312 TTTAACATATTGTTTAAAAAGGG + Intergenic
990141124 5:52705561-52705583 TTTAAATATTCGTATAAAAATGG + Intergenic
990553925 5:56910733-56910755 ATTCAATGGCTTTTTAAAAATGG - Intronic
990559656 5:56971110-56971132 TTTAAATGATTGTTAAGTAAAGG + Intronic
990921087 5:60968254-60968276 TCTAAAAGATTTTTTAAAAATGG - Intronic
991255881 5:64614040-64614062 TTTATAGGGTTGGTTAAATATGG + Intergenic
991727870 5:69554420-69554442 TCTAGTTGGTTTTTTAAAAAAGG - Exonic
991766618 5:69989143-69989165 TTAAAAAGGCTGTGTAAAAATGG - Intergenic
991845849 5:70864230-70864252 TTAAAAAGGCTGTGTAAAAATGG - Intergenic
991908096 5:71532422-71532444 TTAAAATGGATGCTTACAAACGG - Exonic
991936458 5:71806430-71806452 TTAAAATTGTAGCTTAAAAAAGG + Intergenic
992019258 5:72606137-72606159 TTTCAATAGTTGACTAAAAATGG + Intergenic
992059852 5:73032225-73032247 ATTTAATGGTTTTTTTAAAAAGG + Intronic
992076945 5:73200838-73200860 TTTCAATTGTTTTTTTAAAATGG + Intergenic
992372437 5:76157520-76157542 TTTAAATCAGTTTTTAAAAAGGG - Intronic
992916637 5:81460927-81460949 TTTGAATGATTACTTAAAAAAGG + Intronic
993017577 5:82552354-82552376 TTTAAATCTTTGTTTGAAAAAGG + Intergenic
993066886 5:83112198-83112220 TTAAAATGGTAATTTAAAATAGG + Intronic
993092197 5:83440403-83440425 TTTAAATGATTGTTTTCAAAAGG + Intergenic
993105603 5:83596858-83596880 TTTAAATAGATGTTCAAGAAAGG - Intergenic
993139506 5:84013159-84013181 TGTATATGATTATTTAAAAATGG - Intronic
993436130 5:87897292-87897314 TTAAAATTGTTTTTTAAAAAAGG - Intergenic
993646029 5:90463620-90463642 TTTAAATGCTTATTTTATAAAGG + Intronic
993662739 5:90658999-90659021 TTGAAATGATTTTTTAAAAATGG + Intronic
993781404 5:92069989-92070011 TTTAAGTGATTTTTTAGAAAAGG + Intergenic
994078035 5:95675361-95675383 TTTAAAAGTTTCTTAAAAAAGGG + Intronic
994411815 5:99416404-99416426 TTTAAAGGAATGTTTAAGAAAGG + Intergenic
994474204 5:100246757-100246779 TTTAAATCTATATTTAAAAATGG + Intergenic
994482007 5:100348846-100348868 TTTAAAGGAATGTTTAAGAAAGG - Intergenic
994586728 5:101718179-101718201 ATTAAATAGCTTTTTAAAAATGG - Intergenic
994694194 5:103053891-103053913 ATTTAAAGGTTGTTTCAAAACGG - Intergenic
994800174 5:104362963-104362985 TTTAAAAGGTTTCTTACAAAAGG + Intergenic
994861134 5:105196700-105196722 TGTAAGTGGTTGGTTAATAAAGG - Intergenic
994867615 5:105297070-105297092 TTTATTTGTTTTTTTAAAAAAGG + Intergenic
994909966 5:105891250-105891272 TTCAACTGGTTTTTGAAAAAGGG + Intergenic
995165712 5:109039082-109039104 TGTAAATGATTATTTAAAATAGG - Intronic
995172304 5:109130141-109130163 TTTAAATCATTTTTTAAAAATGG - Intronic
995342945 5:111080481-111080503 TTAAAATGGTTATTGTAAAATGG + Intergenic
995781836 5:115784757-115784779 TTCAACTTGTTGTTTAAAAAAGG + Intergenic
995819714 5:116216284-116216306 TTTAAATGTATGTTAACAAAAGG + Intronic
996087536 5:119320387-119320409 TTTAACTTGTTTTTTAAGAAGGG - Intronic
996255260 5:121393884-121393906 CTTAAATTGATTTTTAAAAAGGG - Intergenic
996652381 5:125895478-125895500 TATATATGGTTGTCTTAAAAAGG - Intergenic
996993197 5:129662219-129662241 TTAAGATGGCTGATTAAAAATGG + Intronic
997000750 5:129758141-129758163 TTAAAATATTTATTTAAAAAAGG - Intronic
997302562 5:132816367-132816389 TTCAAATGGTTTTTTAAAATGGG - Exonic
997924088 5:138012035-138012057 TTTGAATTGTTGTATTAAAAAGG - Intronic
998608742 5:143664621-143664643 TTTAAATGATTGGAAAAAAAAGG + Intergenic
998641018 5:144011275-144011297 TTTAGATGGTTATTAAAAATGGG - Intergenic
998665582 5:144293449-144293471 TTTAAATTATTGTTTATAAAGGG + Intronic
998865069 5:146490865-146490887 TCTAAATAGTTGGTTAATAAAGG - Intronic
998923136 5:147093046-147093068 TTAAAATGGATACTTAAAAATGG + Intergenic
999220952 5:149977121-149977143 TTTAGCAGGTTGTTTAAAAAGGG + Intronic
999591114 5:153147684-153147706 TTTAAATAGCTATTTAAAATAGG - Intergenic
999841117 5:155428159-155428181 TTTAAATTGTTATTTTCAAAAGG + Intergenic
999949317 5:156631992-156632014 TTTAAAAATTTATTTAAAAATGG + Intronic
1000003293 5:157160453-157160475 TTTTACAGGTTTTTTAAAAACGG + Intronic
1000482412 5:161795405-161795427 TTTAAATGTGTTTTAAAAAATGG - Intergenic
1000639985 5:163690129-163690151 TATTAATAGGTGTTTAAAAATGG + Intergenic
1000650751 5:163815474-163815496 GAAAAATGTTTGTTTAAAAAGGG + Intergenic
1000709876 5:164559492-164559514 ATTAAATGGTTACTTAAAAGAGG - Intergenic
1000711293 5:164582351-164582373 TTTAAAAAGTTGTTTTCAAAGGG + Intergenic
1000912006 5:167033986-167034008 TTTAAATACTTGTTTTAAAGTGG - Intergenic
1000929476 5:167233908-167233930 GTGAAATGGTGCTTTAAAAAAGG + Intergenic
1002114851 5:176951807-176951829 TATAAATGGTAGTATATAAATGG - Intronic
1002756867 6:169850-169872 TTTAAATATGTGTTTTAAAAAGG + Intergenic
1002969706 6:2002088-2002110 TTTAAAAGTTTGTTTTAAAATGG + Intronic
1003045703 6:2731046-2731068 TTTAAATCTTTTTTTTAAAAAGG - Intronic
1003065030 6:2897150-2897172 TTTAAATATTTGTTTAGAAGAGG - Intronic
1003810184 6:9770389-9770411 TTTAAATGATTGTTTGTAAGAGG + Intronic
1004740193 6:18452642-18452664 TTGAAATTTTTTTTTAAAAAAGG - Intronic
1004762052 6:18678052-18678074 TAGAAAAGGTTGTTTTAAAAAGG - Intergenic
1006699971 6:35964242-35964264 TATACATGGTTGTTGAAATAGGG + Intronic
1007947664 6:45840503-45840525 CTTAACTGGTTGTGTTAAAATGG - Intergenic
1008297706 6:49797986-49798008 TTTAAAAGGGTGTTTCAAGAGGG + Intergenic
1008664178 6:53699746-53699768 TTTAAATGCTTGTTTTAATTTGG - Intergenic
1008695151 6:54027442-54027464 GTTAAATGTTATTTTAAAAATGG + Intronic
1009657249 6:66562852-66562874 AATAATTGGTTGTTTAAAAGAGG - Intergenic
1009784277 6:68312170-68312192 TTAAATTTATTGTTTAAAAATGG - Intergenic
1009859805 6:69312565-69312587 TTGTAGTGGTTGTTTAAAAAAGG + Intronic
1010115032 6:72295025-72295047 CTTAATTGGTTGTATAAAAATGG + Intronic
1010722497 6:79299732-79299754 TTTAAATAGTTTTTTGTAAATGG - Intergenic
1010753372 6:79639640-79639662 TTGAAATGCATATTTAAAAATGG + Intronic
1010788872 6:80040189-80040211 TTAATAGTGTTGTTTAAAAAGGG + Exonic
1010790629 6:80060505-80060527 TTTAAATTGTTTTTCAATAATGG + Intergenic
1010927423 6:81760310-81760332 TTCAAAGAGATGTTTAAAAATGG + Intergenic
1011268373 6:85550309-85550331 TTTAAATTCTTGTTTGCAAAGGG - Intronic
1011476515 6:87754116-87754138 ATTAAATGTTTGCTTAAGAATGG - Intergenic
1011846641 6:91571826-91571848 TTTAAATATTTTTTTAAGAAAGG - Intergenic
1012161586 6:95891265-95891287 TGTAAAAAGTTGTTTTAAAAAGG - Intergenic
1012329793 6:97970538-97970560 TTTAAATGTTTTTTAAAAAGAGG + Intergenic
1012882829 6:104812269-104812291 TTTTAATGTTTTTGTAAAAATGG - Intronic
1013127525 6:107199302-107199324 TTTGATTGGTTGATTAAACAGGG + Intronic
1013165457 6:107586581-107586603 TTTAGATCTTTATTTAAAAATGG + Intronic
1013191191 6:107805477-107805499 TTTAAATGGGGGTATGAAAATGG - Intronic
1013315418 6:108937609-108937631 TGTATATAGTTGTTTAAAAAAGG + Intronic
1013598895 6:111685777-111685799 TTTTGATGGTTGTTTATGAATGG - Intronic
1013602474 6:111718070-111718092 TTTAAATTGTTTTTAAAGAAGGG - Intronic
1013655002 6:112237457-112237479 TTTTACTGGTTTTTAAAAAAGGG - Intronic
1013806008 6:113996632-113996654 TTTAAATTTTTTTTTAAAAAAGG - Intronic
1014050890 6:116953078-116953100 TTCAAATTATTTTTTAAAAAGGG + Intergenic
1014053581 6:116986858-116986880 TTTAAAAGATTCTATAAAAAAGG + Intergenic
1014492987 6:122085307-122085329 TTTAAAAAGTTATTTAAAAAAGG + Intergenic
1014779546 6:125547944-125547966 TTTAAATAAATGTTTAAAAATGG - Intergenic
1015226648 6:130864787-130864809 TTTAAATTGTTGTTGAAACATGG + Intronic
1015605280 6:134948521-134948543 TTTAATTTTTTGTTAAAAAAGGG + Intronic
1015627161 6:135191496-135191518 TTTAAGAGGTTGGTAAAAAAAGG + Intronic
1015690019 6:135911452-135911474 TTTAAAAGTTTGTTCAAAGATGG - Intronic
1015821169 6:137261608-137261630 TTTAAATGGTTGTGGACAAGAGG + Intergenic
1016108706 6:140194236-140194258 TTTACATAGGTGTTTAAAATTGG - Intergenic
1016316534 6:142794915-142794937 TTTAATTCATTGTTTAAAATTGG - Intronic
1016492056 6:144616556-144616578 TTTAAAATCTTTTTTAAAAAAGG - Intronic
1016712334 6:147188384-147188406 TTTAAATAATTTTTAAAAAATGG + Intergenic
1017554268 6:155546160-155546182 TTTAAATCATTTTTTCAAAAAGG - Intergenic
1017576582 6:155811754-155811776 TTGAAATGGATTTTAAAAAATGG - Intergenic
1017673621 6:156792299-156792321 CTTGCATGGTTTTTTAAAAAGGG - Intronic
1017688660 6:156940989-156941011 TTTAAATGGTTGTCATTAAAAGG + Intronic
1017694459 6:157000667-157000689 TAGAAATGGGTGTTTAGAAAGGG - Intronic
1018200596 6:161391191-161391213 TCTACATGGTTGGTTAAAGAAGG - Intronic
1018487432 6:164255753-164255775 TGTAAATGTTTATTTAAAATTGG - Intergenic
1018525155 6:164702311-164702333 ATTACATGTTTTTTTAAAAAAGG + Intergenic
1019782384 7:2950685-2950707 TTTAACTTGTTTTTTAAAATAGG + Intronic
1020463864 7:8454227-8454249 TTAAAATGAAAGTTTAAAAAAGG + Intronic
1020897518 7:13959571-13959593 TCAAAATGATTGCTTAAAAATGG + Intronic
1021163344 7:17302469-17302491 TTTAGATGCTATTTTAAAAATGG - Intronic
1022057965 7:26759837-26759859 TTTAAATGGTTCTCTACAAATGG - Intronic
1022134322 7:27432994-27433016 CTTAAATGGTTTTTTACATATGG + Intergenic
1022644053 7:32214762-32214784 TGTAAACGGTTCTTTATAAAAGG + Intronic
1022801096 7:33778213-33778235 TTTAATTTATTTTTTAAAAAAGG - Intergenic
1023325982 7:39057264-39057286 TTAGAATGGTGGTATAAAAATGG - Intronic
1023645431 7:42307831-42307853 TTTAAAATTTTATTTAAAAATGG - Intergenic
1023868587 7:44250839-44250861 TTTTAAGGTTTTTTTAAAAATGG + Intronic
1024038505 7:45530306-45530328 TTTAAAAGGTTGTGTAAAATCGG + Intergenic
1024173767 7:46816956-46816978 TTTAAAGAGTTGTTTGAAAAAGG + Intergenic
1024437173 7:49371720-49371742 TTAAAATGTTTGTTTATAACTGG + Intergenic
1024579339 7:50789244-50789266 TTTATAAGGTTGGTTAGAAAGGG - Intronic
1024597412 7:50951321-50951343 TTAAAATAGTTATTTAACAATGG + Intergenic
1024895174 7:54251576-54251598 TTTAAAAGCTTGCTTGAAAACGG - Intergenic
1024939117 7:54744071-54744093 TTTTAATCTTTTTTTAAAAAAGG - Intergenic
1025292142 7:57738719-57738741 TTTAAATGGTAGTTAAAAACAGG + Intergenic
1025621700 7:63178551-63178573 TTTATATGTTTGATTTAAAAAGG - Intergenic
1025969863 7:66312553-66312575 TTTTAATAGATTTTTAAAAAGGG - Intronic
1026157091 7:67835859-67835881 TTTAAATTTTTTTTTAGAAATGG - Intergenic
1026460321 7:70608952-70608974 TTTTAATTGATGTATAAAAATGG + Intronic
1026666505 7:72344719-72344741 TATAAATGGCTTTTTATAAATGG + Intronic
1027420891 7:78016741-78016763 TTTAAATCCTTTTTGAAAAAAGG + Intergenic
1027463116 7:78479669-78479691 TTTAAATGTCCATTTAAAAATGG + Intronic
1027634934 7:80659599-80659621 TTTAGAATGTTGTTTTAAAAAGG - Intronic
1028179068 7:87696076-87696098 TTTAAAAGCTTGTTTAACATTGG + Intronic
1028579395 7:92390240-92390262 TTTAAATGGTTTTTAAATAAAGG + Intronic
1028638075 7:93013484-93013506 TTAAAATGTTTTCTTAAAAAGGG + Intergenic
1028989194 7:97032149-97032171 TTTAAATGGTTTTTCCCAAAGGG + Intergenic
1029152228 7:98489175-98489197 TTTAAATTGTTTTGTAAAGATGG - Intergenic
1029630297 7:101746073-101746095 TTTAAATTGTTTTTTAGAGATGG + Intergenic
1030241378 7:107329721-107329743 TTTAAATTTTTGTGTAGAAACGG - Intronic
1030432854 7:109473743-109473765 TTTAATTGGTTGATTATCAAAGG - Intergenic
1030907982 7:115210192-115210214 CTTAAATGTTTCTTTGAAAAAGG + Intergenic
1031223779 7:119008106-119008128 TTTGAATGATTATTTAAAATGGG - Intergenic
1031256599 7:119458807-119458829 TTTAAAGGTTAGTTTCAAAATGG - Intergenic
1031313035 7:120223060-120223082 TTTTATTGGTTGTTTAAACTGGG + Intergenic
1031377053 7:121039719-121039741 TTTAAATGATTTTTTTAAAAAGG - Intronic
1031596374 7:123654211-123654233 CTCAAAAAGTTGTTTAAAAAAGG + Intergenic
1031609028 7:123803294-123803316 TTTAAAAGAATTTTTAAAAAGGG + Intergenic
1031680546 7:124668110-124668132 TTTTGATGGATGTTCAAAAATGG - Intergenic
1031812661 7:126391666-126391688 TTTAAATGCTTTTTTCAAAGAGG - Intergenic
1032288411 7:130562386-130562408 TTTAAATTGTTGTTCTATAAAGG + Intronic
1032749037 7:134818360-134818382 TTTTAATGCTGGTTTACAAAAGG + Intronic
1033090056 7:138377576-138377598 ATTTGATGGTTTTTTAAAAAAGG - Intergenic
1033115704 7:138623284-138623306 TTTATATTGTTTTTTAAAAGAGG - Intronic
1033142420 7:138839713-138839735 TTTAAATGTAGGTTTTAAAAAGG + Intronic
1033201008 7:139370250-139370272 TTTAAAAGGTTAATTACAAAAGG + Intronic
1033468322 7:141618638-141618660 TTTTTTTGTTTGTTTAAAAAAGG + Intronic
1033521873 7:142168719-142168741 TTTAAATGTATATTTTAAAAGGG + Intronic
1033543361 7:142377293-142377315 ATTAAATGGCTGTCTAAAATGGG - Intergenic
1034134028 7:148749050-148749072 TTTAAATGCTTATTTAAAAAAGG + Intronic
1035033116 7:155876865-155876887 TTTTTATGGTTTTTTAAACATGG - Intergenic
1035465105 7:159069813-159069835 TTTAAAATGTTTTTTAAAAGGGG - Intronic
1036168878 8:6464065-6464087 TTTACATGGATATTTACAAAGGG - Intronic
1036207212 8:6814211-6814233 TTCAAATGATTATTTTAAAAAGG + Intronic
1036920689 8:12851807-12851829 TTGAAAACATTGTTTAAAAACGG - Intergenic
1037025627 8:14032863-14032885 TTTCAATAGGAGTTTAAAAATGG + Intergenic
1037158946 8:15743692-15743714 TTTAGAAGTTTGTTTACAAAGGG - Intronic
1037241052 8:16778139-16778161 TTTTAATGGATGTTAAATAAAGG + Intergenic
1037330194 8:17736521-17736543 TTTAAACGGTTGGTCAAGAAAGG - Intronic
1037869877 8:22483726-22483748 ATAAAATGGTTATTTAAGAAAGG - Intronic
1037897613 8:22668723-22668745 CCTCAATGGGTGTTTAAAAAAGG + Intronic
1037941428 8:22954064-22954086 GTTAAAGGGTGGTTTCAAAAAGG + Intronic
1038053915 8:23839677-23839699 TTTAATTAGTTATTTATAAATGG + Intergenic
1038089150 8:24234403-24234425 TTTAAAGGGTTGTAAAAACAAGG + Intergenic
1038134632 8:24771976-24771998 TTTAAATGGTTCACTAAAATGGG + Intergenic
1038246553 8:25861936-25861958 TTTAAAAGGCTGTGTAAAACAGG - Intronic
1038262219 8:26005923-26005945 TTTAATTTGTGGTTTTAAAATGG + Intronic
1038433998 8:27522004-27522026 TTTTAATGGTTGTTTAAGGGAGG + Intronic
1039302737 8:36227283-36227305 TTGGAATAGTTTTTTAAAAATGG - Intergenic
1039664402 8:39507561-39507583 TTTTAATGTTTGATTAAAATAGG - Intergenic
1039688226 8:39831856-39831878 TTTAAATGTATATTTAAAATTGG - Intronic
1040022144 8:42750278-42750300 TTGAACTGGATGCTTAAAAATGG + Intergenic
1040396541 8:47006186-47006208 AATAACTGGTTGTTTAAAAAAGG - Intergenic
1041194591 8:55388064-55388086 GTTAAATGGTTGTTTCACTAGGG + Intronic
1041374232 8:57196194-57196216 AATAAATGGATTTTTAAAAATGG - Intergenic
1041745068 8:61199612-61199634 TTTAAATGGATGTGGTAAAAAGG + Intronic
1042193990 8:66216180-66216202 TTTAAATTGTTTTGTAAAGATGG - Intergenic
1042520282 8:69704206-69704228 TTTAAATGGCTCTCTAAAAAAGG - Intronic
1043082344 8:75782668-75782690 TTCAAATGCGTGTATAAAAATGG + Intergenic
1043287203 8:78547729-78547751 TTTAAAAGGTTGACTAGAAAAGG - Intronic
1043401483 8:79889571-79889593 TCTAAATGATTTTTTATAAATGG + Intergenic
1043528718 8:81125836-81125858 CTTATATGGTTGTTTAGGAAGGG + Intergenic
1043786439 8:84406596-84406618 TGTAAATGGTTTATTCAAAATGG - Intronic
1043825662 8:84925715-84925737 TTTAAATGAGTGTTTCAAATAGG + Intergenic
1043973490 8:86559428-86559450 TGAAAATGGTTCTTAAAAAAAGG - Exonic
1044107301 8:88225982-88226004 ATAAAATAGTTGTATAAAAATGG - Intronic
1044150337 8:88769080-88769102 TTTACATAGTTATTTGAAAAGGG - Intergenic
1044204249 8:89473737-89473759 TTTAAAAGATGGATTAAAAAAGG - Intergenic
1044260852 8:90118628-90118650 TTTAAATGGTTGTTAAATGCTGG - Intergenic
1044650880 8:94493688-94493710 TGTATGTGGTTTTTTAAAAAAGG + Intronic
1044688254 8:94849824-94849846 TTTAAATGGCTTATTAAAATTGG + Intronic
1044801925 8:95965762-95965784 ATTTAATGGTTATTTAAAAGTGG + Intergenic
1044815181 8:96104978-96105000 AATAAATGTTTTTTTAAAAATGG + Intergenic
1045010977 8:97958086-97958108 TTGAAATGGTACTTTCAAAAGGG + Intronic
1045247139 8:100452748-100452770 CATAAATGTTTGTTTAATAAAGG - Intergenic
1045444383 8:102245180-102245202 TATAAAAGGTTTTTTTAAAAAGG - Intergenic
1045771719 8:105749178-105749200 TTTAAAAGATTGTGTAAAGATGG + Intronic
1046012012 8:108560400-108560422 TTTGTATGGGTTTTTAAAAAAGG - Intergenic
1046190699 8:110790867-110790889 TTTAGATGATTATTTAAAAATGG + Intergenic
1046687016 8:117238999-117239021 TGTAAACAGTTGTTTTAAAAAGG + Intergenic
1046709821 8:117498242-117498264 TTCAAAAGGTTTTTTAAAAATGG + Intergenic
1047295271 8:123565147-123565169 CTTAATTGGTTAATTAAAAAGGG + Intergenic
1047730283 8:127722299-127722321 TTTAAAAGTTTATTTAATAATGG - Intergenic
1047890868 8:129307218-129307240 GTTAAATGGTTATTTAATAGGGG + Intergenic
1047969028 8:130069181-130069203 TTTAGATGGTTATTAAGAAATGG + Intronic
1048192366 8:132301513-132301535 TTTAATTAGTTGTTTAATTATGG - Intronic
1050389697 9:5127740-5127762 ATTAGATTGTTTTTTAAAAATGG + Exonic
1050706405 9:8403859-8403881 ACTAAATGGTTATTTTAAAAGGG - Intronic
1050724801 9:8636532-8636554 TCTAAATGGCTTTTTAAAAAAGG - Intronic
1051253266 9:15184285-15184307 TGTGAAAGGTTTTTTAAAAATGG - Intronic
1051314684 9:15816795-15816817 ATTATATGGTTCATTAAAAAAGG - Intronic
1051386478 9:16514485-16514507 TTTAGATTTTTTTTTAAAAAGGG + Intronic
1052031293 9:23631926-23631948 TTTCAAAGGTTGTTAAAAATGGG + Intergenic
1052054547 9:23888994-23889016 TTTAAATTGTTATTTTAAATTGG + Intergenic
1052199590 9:25762040-25762062 TTTAAATGATTATTTTAAATTGG - Intergenic
1052646423 9:31241068-31241090 TTTAAAAGGTTCTTTACAGAGGG - Intergenic
1052792406 9:32887957-32887979 TTAAAATGCATGATTAAAAAAGG - Intergenic
1053507776 9:38659004-38659026 TGTAAATAGCTTTTTAAAAATGG + Intergenic
1053641931 9:40091682-40091704 TTCAATTGATTGTTTAAACAAGG + Intergenic
1053689121 9:40573137-40573159 TTTAAATTGGTGTTAAGAAAGGG - Intergenic
1053764205 9:41373778-41373800 TTCAATTGATTGTTTAAACAAGG - Intergenic
1054164359 9:61706979-61707001 TTTAAATGGTAGTTAAAAACAGG - Intergenic
1054274912 9:63057929-63057951 TTTAAATTGGTGTTAAGAAAGGG + Intergenic
1054300365 9:63374069-63374091 TTTAAATTGGTGTTAAGAAAGGG - Intergenic
1054322825 9:63689076-63689098 TTCAATTGATTGTTTAAACAAGG + Intergenic
1054399913 9:64707000-64707022 TTTAAATTGGTGTTAAGAAAGGG - Intergenic
1054433501 9:65191261-65191283 TTTAAATTGGTGTTAAGAAAGGG - Intergenic
1054496884 9:65830408-65830430 TTTAAATTGGTGTTAAGAAAGGG + Intergenic
1054542818 9:66284960-66284982 TTCAATTGATTGTTTAAACAAGG - Intergenic
1054715185 9:68550449-68550471 TTAAAATTTTTCTTTAAAAAAGG + Intergenic
1054744561 9:68841593-68841615 TTTTAATAGTTCTTTGAAAATGG + Intronic
1054892997 9:70272355-70272377 TTAAAATGTTTTTTTAAAAAAGG + Intronic
1054969664 9:71070513-71070535 TTTAGATTTTTTTTTAAAAAAGG - Intronic
1055076338 9:72219098-72219120 TTAAAATGTTTATTTGAAAATGG + Intronic
1055199656 9:73645160-73645182 TTAAATAGGTTGCTTAAAAAAGG - Intergenic
1055211176 9:73794681-73794703 TAAAAATGGTTATTTGAAAAAGG - Intergenic
1055306501 9:74934875-74934897 TACAAATGCTTGTTTAACAATGG + Intergenic
1056057910 9:82847850-82847872 TTTAAATGGTTCTCTACATATGG - Intergenic
1056095177 9:83245351-83245373 CTTAAATGGATGTTTCTAAAAGG + Exonic
1056434436 9:86561785-86561807 TTTCAATGGGAATTTAAAAAAGG + Intergenic
1056495478 9:87150547-87150569 CTTAATTTGTTTTTTAAAAACGG + Intronic
1057174222 9:92984255-92984277 AATAACTGGTTGTTTAAAAGAGG - Intronic
1057492353 9:95530762-95530784 TTAAAATTGTTGTTTAGACAGGG - Intergenic
1057613535 9:96567613-96567635 TTTAAATGGTTGTTTAAAAAGGG - Intronic
1057667065 9:97054382-97054404 TTTAGACGGTTATTTAAAAATGG + Intergenic
1058131597 9:101259962-101259984 TTTTAATCGTTTTTTAGAAATGG + Intronic
1058536710 9:105968201-105968223 TTTGAATGGTTTTTTAGAAGGGG + Intergenic
1058860308 9:109111549-109111571 TTAAAATGGTTATTTTAAACTGG - Intronic
1059178177 9:112186972-112186994 CTCACATGGTTGTTTAAACATGG + Intergenic
1059206580 9:112472792-112472814 TTTAAATGGTTATTTTAAAAAGG - Intronic
1059299454 9:113300456-113300478 TTTTAATGGTTGTTAATAAAGGG + Intronic
1059835503 9:118147672-118147694 TCTAAATTGTTGTTTTTAAAGGG - Intergenic
1061016779 9:127985640-127985662 TTTAAATATTTGTTTAGAGACGG - Intergenic
1061708468 9:132470989-132471011 TTTAAATGATATTTTATAAATGG + Intronic
1062432997 9:136534308-136534330 TTGAATTGGTTGTTTAAAGCTGG - Intronic
1202789696 9_KI270719v1_random:74644-74666 TTCAATTGATTGTTTAAACAAGG + Intergenic
1186125543 X:6409844-6409866 TTCAAATGGCTTTTGAAAAAGGG + Intergenic
1186143878 X:6605376-6605398 TTAAAATGTCTGCTTAAAAATGG + Intergenic
1186720361 X:12297231-12297253 TTGAGATGGCTTTTTAAAAATGG + Intronic
1187044011 X:15627492-15627514 TGTAAATGGATGGATAAAAATGG - Exonic
1187054189 X:15726167-15726189 TTAAAATGGTAGTTAATAAAAGG - Intronic
1187216266 X:17280105-17280127 TTTAACGGATTGTTGAAAAAAGG + Intergenic
1187258631 X:17664488-17664510 TTGAACTGATTGTTTGAAAAAGG - Intronic
1187758402 X:22551052-22551074 TTTAAAGGCATTTTTAAAAAGGG + Intergenic
1187865915 X:23723246-23723268 TATAAATGCTTGTTAAAATATGG - Intronic
1187913650 X:24133217-24133239 TTGAAGTGGTGGTTTAAACAAGG + Intergenic
1188140509 X:26544664-26544686 TTTAAATGCTGGTTTAAAGAAGG + Intergenic
1188170145 X:26914201-26914223 TTTAAATGTTTGATTTACAAAGG - Intergenic
1188192197 X:27185150-27185172 TTTAAATGGTAATTTATATATGG - Intergenic
1188331984 X:28884648-28884670 TTCAAAAGCTTGTTTATAAAAGG - Intronic
1188628752 X:32323644-32323666 ATAAAATTGTTGTTTAAAATGGG + Intronic
1188746012 X:33844746-33844768 TCTAAATGATTCTTTAAAAAAGG - Intergenic
1188755848 X:33961769-33961791 TTTAAATAATTATTTAAACAAGG + Intergenic
1188811079 X:34655528-34655550 TTTAATTTTGTGTTTAAAAAAGG - Intronic
1189114058 X:38325841-38325863 TTTAAATGGTTATTGGGAAATGG - Intronic
1189948728 X:46206581-46206603 TTAAAATGGTTTTTAGAAAATGG + Intergenic
1190961875 X:55259039-55259061 TTTATATGGTTGTTTTAAGTAGG + Intronic
1192824873 X:74684379-74684401 TTTTATTGTTTTTTTAAAAAGGG - Intergenic
1193598806 X:83482658-83482680 TTGAAATGGTAATTAAAAAATGG - Intergenic
1193750747 X:85340156-85340178 TTAAAAAGGCTGTTTAACAATGG + Intronic
1194544022 X:95209339-95209361 CTTCAATGGTTGTGTACAAAAGG + Intergenic
1194642812 X:96423381-96423403 TAGAAATGGTCTTTTAAAAATGG + Intergenic
1194726659 X:97406232-97406254 TTCAAATTGTTTTTTAAAAATGG + Intronic
1194736557 X:97519200-97519222 TTTATTGGGTTGTTTAAATAGGG - Intronic
1195298029 X:103499687-103499709 TTTAAACGTGTGTTTATAAAGGG - Intergenic
1195518421 X:105803498-105803520 TTTGAATGGATCTTTAGAAAAGG + Intergenic
1195565957 X:106339464-106339486 TTTAGATGGTTATTAAGAAATGG - Intergenic
1195728334 X:107939910-107939932 AATAAATGGTAGATTAAAAATGG + Intergenic
1195763098 X:108268212-108268234 TTAAAATGGTTCATTTAAAAAGG + Intronic
1196353434 X:114760244-114760266 TTGAAATGGTTGTTCCACAAAGG + Intronic
1196384602 X:115135501-115135523 TTTTAATGGATGTGCAAAAAAGG + Intronic
1196400893 X:115315064-115315086 AATAACTGGTTGTTTAAAAGAGG - Intergenic
1196616444 X:117771321-117771343 TTTCAATGCTAGTTTAAAATTGG - Intergenic
1196677925 X:118439947-118439969 TTTAAATTTTTTTATAAAAATGG - Intronic
1196984944 X:121258844-121258866 ATTAATTGGATGTTGAAAAAAGG + Intergenic
1197138856 X:123094487-123094509 TTTAAAGGGTGGTTAAAAGAAGG - Intergenic
1197196636 X:123709061-123709083 TCTAAATGCCTATTTAAAAATGG + Intronic
1197264142 X:124348061-124348083 TGTATATTGTTTTTTAAAAACGG + Intronic
1197329295 X:125133808-125133830 TGGAAATTGTTTTTTAAAAACGG + Intergenic
1197492725 X:127138685-127138707 TTTAGATGGTTATTAAGAAATGG + Intergenic
1197743297 X:129912538-129912560 TTTAAATGCTTTTTAAAAACTGG - Intronic
1197865794 X:131015324-131015346 TTCAAATGTTGGTTTCAAAATGG - Intergenic
1198397590 X:136236198-136236220 TTTAAATAGTGATTTAAAAGAGG - Intronic
1198720305 X:139611015-139611037 TTTAAATGTTTAGTTTAAAAAGG + Intronic
1198738068 X:139809651-139809673 TAAAAATGGTTACTTAAAAATGG + Intronic
1199518074 X:148701329-148701351 TTTAAAGTGCTTTTTAAAAATGG + Intronic
1199555934 X:149108785-149108807 TTTCAAAGGTGGTTTCAAAAGGG - Intergenic
1199899062 X:152155240-152155262 TTTTAAGTGTTCTTTAAAAAGGG + Intergenic
1201221374 Y:11773933-11773955 TCTAAATGTTTTTTGAAAAATGG - Intergenic
1201341072 Y:12935278-12935300 TTTTAATGCTTGTTTAAAAAAGG + Intergenic
1201363371 Y:13177349-13177371 AATAACTAGTTGTTTAAAAAGGG + Intergenic
1201927503 Y:19304261-19304283 TTTAAAGTTTTCTTTAAAAAAGG - Intergenic
1202346969 Y:23941335-23941357 GTTAAATGATTGTTTTATAAAGG + Intergenic
1202523802 Y:25728755-25728777 GTTAAATGATTGTTTTATAAAGG - Intergenic