ID: 1057613536

View in Genome Browser
Species Human (GRCh38)
Location 9:96567614-96567636
Sequence TTTTAAATGGTTGTTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1086
Summary {0: 1, 1: 1, 2: 14, 3: 102, 4: 968}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057613536_1057613543 22 Left 1057613536 9:96567614-96567636 CCTTTTTAAACAACCATTTAAAA 0: 1
1: 1
2: 14
3: 102
4: 968
Right 1057613543 9:96567659-96567681 AAGGATGGTTATCGGAGGCTGGG No data
1057613536_1057613544 27 Left 1057613536 9:96567614-96567636 CCTTTTTAAACAACCATTTAAAA 0: 1
1: 1
2: 14
3: 102
4: 968
Right 1057613544 9:96567664-96567686 TGGTTATCGGAGGCTGGGAAAGG No data
1057613536_1057613540 14 Left 1057613536 9:96567614-96567636 CCTTTTTAAACAACCATTTAAAA 0: 1
1: 1
2: 14
3: 102
4: 968
Right 1057613540 9:96567651-96567673 GAGAGTAGAAGGATGGTTATCGG No data
1057613536_1057613542 21 Left 1057613536 9:96567614-96567636 CCTTTTTAAACAACCATTTAAAA 0: 1
1: 1
2: 14
3: 102
4: 968
Right 1057613542 9:96567658-96567680 GAAGGATGGTTATCGGAGGCTGG No data
1057613536_1057613541 17 Left 1057613536 9:96567614-96567636 CCTTTTTAAACAACCATTTAAAA 0: 1
1: 1
2: 14
3: 102
4: 968
Right 1057613541 9:96567654-96567676 AGTAGAAGGATGGTTATCGGAGG No data
1057613536_1057613538 3 Left 1057613536 9:96567614-96567636 CCTTTTTAAACAACCATTTAAAA 0: 1
1: 1
2: 14
3: 102
4: 968
Right 1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG No data
1057613536_1057613539 7 Left 1057613536 9:96567614-96567636 CCTTTTTAAACAACCATTTAAAA 0: 1
1: 1
2: 14
3: 102
4: 968
Right 1057613539 9:96567644-96567666 AGAGATAGAGAGTAGAAGGATGG 0: 26
1: 280
2: 840
3: 2118
4: 5704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057613536 Original CRISPR TTTTAAATGGTTGTTTAAAA AGG (reversed) Intronic
900924713 1:5697504-5697526 TTTAGAATGGTTATTTAGAATGG + Intergenic
901780213 1:11589195-11589217 TTTTAAATTTTTTTTTAAACAGG - Intergenic
903556704 1:24199195-24199217 TTTTAAATGACTTTTCAAAAAGG + Intergenic
905014624 1:34769051-34769073 TTTAAAGTGATTTTTTAAAATGG - Intronic
905553722 1:38864902-38864924 TTTTAAAGGTTTATATAAAAAGG - Intronic
905640459 1:39586152-39586174 TTTTAAATGTTTGTAGAAATGGG - Intergenic
906540853 1:46584818-46584840 TTTTAAATTATAGTTTAGAATGG + Intronic
906623428 1:47304996-47305018 TTTTACATTGTTTTTTCAAAAGG - Exonic
907817418 1:57933823-57933845 TTGTAGATGGTAGTATAAAACGG - Intronic
908002245 1:59691654-59691676 TTTTAACTGTATGTTTCAAAGGG + Intronic
908379102 1:63577518-63577540 TTTGTAATGGATATTTAAAAAGG - Intronic
908438420 1:64129750-64129772 TTTCAAATGTGTGTTTAAATAGG + Intronic
908599236 1:65721020-65721042 TTTTAAATGTTTATTTACAATGG - Intergenic
909258712 1:73458818-73458840 TTTTAAATGTTTGTTTATAATGG + Intergenic
909345464 1:74580492-74580514 TTCTAAATGTTCTTTTAAAAAGG + Intronic
909620068 1:77657863-77657885 TGTTAAGTGGTTGTTGAAATGGG - Intronic
909626517 1:77722563-77722585 TTTAAAATATTTTTTTAAAAGGG + Intronic
910165344 1:84322024-84322046 TTTTCAATGGCAGTTTAAAAAGG - Intronic
910210314 1:84785405-84785427 TATTAATTGGTTGTTTGAAATGG - Intergenic
910432097 1:87168825-87168847 TATTAAGTGGATATTTAAAATGG - Exonic
910821065 1:91347324-91347346 TTGTAAATCATTTTTTAAAAAGG - Intronic
910979776 1:92948419-92948441 TTTTAAAAACTTTTTTAAAAAGG + Intronic
911029710 1:93473537-93473559 TTATAAATGCTTGTTGAAGATGG - Intronic
911244266 1:95499349-95499371 TTTTAATTGCTTCTTTTAAATGG - Intergenic
911288471 1:96027347-96027369 TTTTAAATTGAATTTTAAAAAGG + Intergenic
911353478 1:96785744-96785766 GTTTAAATTGTTTTTTTAAAAGG - Intronic
911366031 1:96938479-96938501 TAATAAATGCTTGTTTAATAGGG - Intergenic
911460179 1:98179747-98179769 TTTTAAATAATTGTTGCAAAAGG + Intergenic
911592512 1:99764559-99764581 TTTTAAATGGATCTTGAAAGAGG - Intronic
911697431 1:100906729-100906751 ATTTAAATTGTTGTTTTAGATGG + Intronic
911997007 1:104778110-104778132 TTTTAAATAGGTGTTTGATATGG - Intergenic
912633858 1:111272555-111272577 TTTTTAATGGTTTTTTAATAGGG - Intergenic
912653826 1:111467756-111467778 TTTAAATTGGTTGTTTAAGTTGG - Intergenic
913077156 1:115350354-115350376 TTTCAAATAGCTGTTTTAAAAGG + Intergenic
913126696 1:115797273-115797295 TTTTTAATTGTAGTTTTAAATGG - Intergenic
913376260 1:118155983-118156005 TTGAAAATGTATGTTTAAAATGG + Intronic
914707699 1:150184553-150184575 TTCTGAATGGTTTTTAAAAATGG - Intergenic
914756509 1:150564749-150564771 TTTTAAATGGTTGAAAAAAATGG - Intergenic
915077904 1:153326524-153326546 TATAAAAAGGTTGTTTAAAATGG + Intergenic
915145981 1:153795993-153796015 TTTTAAATCATAGTTTACAATGG - Intergenic
915678011 1:157549676-157549698 TTTTAAATGAATTTTTTAAAGGG - Intronic
915687046 1:157644152-157644174 TTTTAAATGAATTTTAAAAATGG + Intergenic
916305656 1:163328019-163328041 TTTTAAATGAATTTTAAAAATGG - Intronic
917167704 1:172131406-172131428 CTTGGAATGTTTGTTTAAAAAGG + Intronic
917225600 1:172778317-172778339 TTTTTACTGGTTGTTTTAATAGG + Intergenic
917345390 1:174023162-174023184 TATTAAATGGTTGTTTATTTGGG - Intergenic
917882080 1:179346971-179346993 TTTTAAACAATTGTTTAAGAGGG + Intronic
917908601 1:179616060-179616082 TTTTAAATGGCTGTGGGAAAAGG - Intronic
917993934 1:180414936-180414958 TTTTTAATGGTGGTTAAATATGG - Intronic
918273600 1:182928009-182928031 TTTTAAAAAGATGTTTTAAAAGG + Intronic
918436150 1:184515293-184515315 TTTAAAATTGATTTTTAAAAAGG + Intronic
918507008 1:185266490-185266512 TTTTAAATGATGAATTAAAATGG - Intronic
918568121 1:185954533-185954555 TTGTTGATTGTTGTTTAAAAAGG - Intronic
918796204 1:188900240-188900262 TTTCAAAAATTTGTTTAAAATGG - Intergenic
918854495 1:189733442-189733464 TTTTTTATGTTTGTTTAAACTGG + Intergenic
918867916 1:189927026-189927048 TTTTAAAAAGATTTTTAAAAAGG - Intergenic
919298904 1:195735764-195735786 AAATAACTGGTTGTTTAAAAAGG + Intergenic
919300666 1:195759648-195759670 CTTAAAATGTTTATTTAAAATGG + Intergenic
919487656 1:198163828-198163850 TTTTAAATGCATTTTGAAAATGG - Intronic
920025896 1:202995753-202995775 TTTTATATGAATGTTCAAAAGGG - Intergenic
920798720 1:209166614-209166636 TTTTAAATGGTTTTGGAAATAGG - Intergenic
920922073 1:210306072-210306094 TTATTATTGGTTTTTTAAAAAGG - Intergenic
921434691 1:215104663-215104685 TTATAAATGGATTTTTAAAAAGG + Intronic
921460166 1:215415693-215415715 TTTTAAAAGGTGTTTTTAAAAGG + Intergenic
921462813 1:215448952-215448974 TTTTAAAAGGTGTTTTTAAAAGG - Intergenic
921973207 1:221173757-221173779 TTTTAAATGATTTTTTGGAAGGG + Intergenic
922491745 1:226022889-226022911 TTTAAAATGTTTATATAAAAAGG - Intergenic
922638836 1:227206062-227206084 TTTTAAAAGGTTTTATAAAAAGG + Intronic
922852422 1:228745006-228745028 CTTTAACTGGTTGTTTTAACAGG - Exonic
923210617 1:231801064-231801086 TTTTAAATGGTATTTTAAGAAGG + Intronic
924126853 1:240863756-240863778 TTTAAAATGGTATTTTAAAACGG - Intronic
924136442 1:240972214-240972236 TCTGAAATAGTTGTTCAAAAAGG + Intronic
924316097 1:242798406-242798428 TTTTAAATTGTTCTTTTTAATGG - Intergenic
924525851 1:244847430-244847452 TTTAAAATGTTTTCTTAAAAAGG + Intronic
924616473 1:245615878-245615900 ATTTGGAGGGTTGTTTAAAATGG + Intronic
924862595 1:247940341-247940363 TTTTAAATGGTTTTATTAATAGG + Intronic
1062827606 10:584215-584237 TTTTAAATGCCTGTTGAATAGGG - Intronic
1063207498 10:3847990-3848012 TTCTAACTGATTTTTTAAAAAGG - Intergenic
1063398960 10:5722695-5722717 TTTAAAATGAGTTTTTAAAAAGG + Intronic
1063573244 10:7236802-7236824 TTTTTAATGGTTTTTTTTAATGG - Intronic
1063647610 10:7900931-7900953 TTTTAAATTATTTTTTAAATGGG + Intronic
1063788809 10:9416005-9416027 TTTTAAAAGGTTGATTGTAATGG - Intergenic
1063853352 10:10218517-10218539 TTTGAAATGGTTGTTTAGAAAGG - Intergenic
1063880206 10:10523349-10523371 ATTTAAATGATTTTTTAAATGGG + Intergenic
1064375615 10:14792913-14792935 TTTTAAATGGTGATAGAAAATGG - Intergenic
1064500511 10:15967029-15967051 TTTTAAAGCGTCATTTAAAATGG - Intergenic
1064637483 10:17384372-17384394 TTTTACATAGTTTTTTAAATTGG - Intronic
1064721138 10:18230125-18230147 TTTTACATAGTTGGTTCAAAAGG + Intronic
1065599036 10:27349927-27349949 TTTTACATGGTTGTGTCAAGTGG - Intergenic
1065604002 10:27397308-27397330 TTTTAAATAATAATTTAAAATGG + Intergenic
1065615745 10:27521044-27521066 ATTTTATTGGTTGTTTAAAAGGG + Intronic
1065769691 10:29066288-29066310 CTTTAAAAGGATCTTTAAAAGGG - Intergenic
1066146689 10:32566601-32566623 TTTTAAATGTTTATCTAAATTGG - Intronic
1066587847 10:36957519-36957541 TTTTAAATAATTTTTAAAAATGG + Intergenic
1067366985 10:45641381-45641403 TTTTATATGGTTGTAAGAAATGG + Intronic
1067678181 10:48405084-48405106 TATTAAAACATTGTTTAAAAGGG + Intronic
1067946131 10:50689576-50689598 TTTAAGATGGTTTTTAAAAAAGG - Intergenic
1068021677 10:51593546-51593568 TTTGAGATGTTTGTTAAAAATGG - Intronic
1068110196 10:52671345-52671367 TTTAAAATGATAGTGTAAAATGG - Intergenic
1068402698 10:56550986-56551008 TTTTATTTGGTTGTTTTAATTGG + Intergenic
1068764966 10:60752755-60752777 TTTTAAAAGGTTTTTAAAATTGG + Intergenic
1068784132 10:60951762-60951784 TGGTAAATGGTTGTTAATAATGG + Intronic
1068784134 10:60951782-60951804 TGGTAAATGGTTGTTAATAATGG + Intronic
1069107374 10:64399589-64399611 TTTTAAATTTTTGTTTAAATAGG + Intergenic
1069291145 10:66781262-66781284 TTTTAAAAGGTTGAATAAAATGG - Intronic
1070088374 10:73258770-73258792 TCTTATATGGTTGTATATAAGGG + Intronic
1070273541 10:74982092-74982114 GTCTAAATGGTTGCTTAATATGG - Intronic
1070433923 10:76369725-76369747 ATTTAAATGCTAGTTTAACATGG + Intronic
1070698609 10:78582412-78582434 TTTTAAATGATTATTCCAAAGGG + Intergenic
1070881444 10:79854576-79854598 TTTAAGATGGTTTTTAAAAAAGG - Intergenic
1071199707 10:83206115-83206137 AGTTAAACTGTTGTTTAAAATGG - Intergenic
1071312874 10:84360124-84360146 TTTTAAATGGAAGTTTTATATGG + Intronic
1071648019 10:87370890-87370912 TTTAAGATGGTTTTTAAAAAAGG - Intergenic
1071814398 10:89218123-89218145 TTTTAAATGTCATTTTAAAACGG - Intronic
1071903859 10:90151152-90151174 CTGTAATTGGTTGTTAAAAATGG + Intergenic
1072327159 10:94310082-94310104 TTTAAAATGTATGTTTAAAGAGG - Intronic
1072345344 10:94499503-94499525 TTTTAAAATGTTATGTAAAAAGG - Intronic
1072553947 10:96500349-96500371 TTTTGAAGGGTTGTTTGAAAAGG + Intronic
1072597267 10:96885827-96885849 TTTTATATTTTTGTTAAAAAGGG + Intronic
1072703973 10:97666617-97666639 TTTTTAATGGTTTTTTTAATTGG + Intronic
1073276576 10:102316928-102316950 TTTAAAATAATTATTTAAAATGG - Intronic
1073443756 10:103568665-103568687 TTTTAAATGGTGGTTTTCAGTGG - Intronic
1073555742 10:104449289-104449311 TTTTAAATATTTGCATAAAAGGG - Intronic
1073615304 10:104989167-104989189 TTTTAAATGGTTTAATTAAACGG + Intronic
1073820875 10:107262925-107262947 TTTTAATTGTATGTTTAGAAAGG + Intergenic
1074090846 10:110253476-110253498 TTTAAGATATTTGTTTAAAAAGG + Intronic
1075036531 10:119073997-119074019 ATTGAAATAGCTGTTTAAAAAGG - Intronic
1076783297 10:132736390-132736412 TGGTAACTGGTTGTTAAAAATGG - Intronic
1077507374 11:2936673-2936695 ATGTAAATGCTTTTTTAAAAAGG - Intergenic
1077719126 11:4609340-4609362 TGTTAAATAAATGTTTAAAATGG - Intergenic
1078236742 11:9491946-9491968 ATTTATTTGTTTGTTTAAAATGG + Intronic
1078781722 11:14445102-14445124 ATTTATATGGTTGAATAAAAAGG + Intronic
1079157054 11:17957834-17957856 TTTAAAATGATCATTTAAAATGG - Intronic
1079372323 11:19862198-19862220 TCTTAAAAAGTTTTTTAAAAAGG + Intronic
1079619595 11:22537031-22537053 TTTTAGTTAGTTGTGTAAAAAGG + Intergenic
1079909620 11:26293135-26293157 TTTTAAAAGGTGTTTTGAAAAGG + Intergenic
1079932617 11:26583998-26584020 TTTAATATGGTTGATTAGAAGGG - Intronic
1080078967 11:28191100-28191122 TTATAAATTGTTTTTTAGAATGG + Intronic
1080270321 11:30444517-30444539 TTTGGAATGTTTGTTTTAAATGG - Intronic
1080289092 11:30651032-30651054 TATTAAATTATTTTTTAAAAAGG + Intergenic
1080416373 11:32073228-32073250 ATTTAAATGGTTCATTTAAATGG + Intronic
1080548364 11:33344940-33344962 TTTTAAATGTTTCTTGTAAATGG - Intronic
1081552916 11:44130780-44130802 TTTTTAATGGACTTTTAAAAAGG + Intronic
1082601463 11:55162127-55162149 TTTTCAATGGGGGCTTAAAAGGG + Intergenic
1082689623 11:56284007-56284029 TTTTAAACCGTTGTTGAAATTGG + Intergenic
1083071012 11:59981490-59981512 ATTTAAAAAATTGTTTAAAATGG + Intergenic
1083356833 11:62072753-62072775 TTTTAAATTTTTGGTTGAAATGG + Intergenic
1083699192 11:64463687-64463709 TTTTATATCTCTGTTTAAAAGGG + Intergenic
1083921499 11:65783485-65783507 ATTTAAAATGGTGTTTAAAAAGG + Intergenic
1083921500 11:65783486-65783508 TTTAAAATGGTGTTTAAAAAGGG + Intergenic
1084136983 11:67191417-67191439 TTTTACATCATTGTTCAAAAAGG - Intronic
1084584897 11:70053012-70053034 TTTTTTAATGTTGTTTAAAAAGG + Intergenic
1085752772 11:79176539-79176561 TTTTAAATAGTTTTTTTAATTGG - Intronic
1086119622 11:83292583-83292605 TTTTAAATGGGAGCTTATAAAGG - Intergenic
1086355629 11:85996020-85996042 TTGTAAATGTTTGTTGAATAAGG - Intronic
1086813722 11:91342652-91342674 TTTTATAGGGATGTTGAAAAAGG - Intergenic
1087345648 11:96967608-96967630 TTTTTAATGATTATTTTAAAGGG - Intergenic
1087559418 11:99766758-99766780 TTTAAAATGCTTGTTAAAATAGG - Intronic
1087569961 11:99913854-99913876 TTTTAACTGAATTTTTAAAATGG - Intronic
1087639018 11:100735521-100735543 TTTTACAGGGCTTTTTAAAAAGG + Intronic
1087640013 11:100746525-100746547 ATGTAAATGCTTGGTTAAAATGG - Intronic
1087643796 11:100784303-100784325 CCTTAAATGGATTTTTAAAAGGG - Intronic
1087733801 11:101809188-101809210 TTTTAACTGATCTTTTAAAAAGG - Intronic
1087855580 11:103088260-103088282 CTCAAAATGTTTGTTTAAAATGG - Intronic
1088055230 11:105567265-105567287 TTCGAAAGGGTTGATTAAAATGG + Intergenic
1088091445 11:106044723-106044745 TGTTAAAAGGTTGTTTTAAAAGG + Intergenic
1088419509 11:109627821-109627843 TTTTAATTGGTTTGTTAATATGG - Intergenic
1088542181 11:110924591-110924613 TTTTAAATGTTTGTTGCAATTGG + Intergenic
1088748104 11:112821493-112821515 TTATTAATCTTTGTTTAAAAAGG + Intergenic
1088765306 11:112969711-112969733 TTTGAAATGTTTGTTTAAAAAGG + Intronic
1089855274 11:121538148-121538170 TTTGAGATGGCTGTTAAAAATGG - Intronic
1090215701 11:124961917-124961939 TTCTAATTGGTAGTTTATAATGG + Intronic
1091495684 12:970696-970718 TTACAAATGGTTGTTCAGAATGG + Intronic
1091978837 12:4849397-4849419 TTTTCTTTGGTTGTTTCAAAGGG - Intronic
1092049942 12:5461429-5461451 TTTTAAATGGTTGGCTACATGGG + Intronic
1092243291 12:6848830-6848852 TTTTAAATGTTACTTTAAAAAGG - Exonic
1093175026 12:15903714-15903736 ATTTAAATAATTGTTTAAAAAGG - Intergenic
1093256905 12:16879885-16879907 TTTTATAAGCATGTTTAAAAGGG + Intergenic
1093472605 12:19519886-19519908 TCTGGAATGGTTGTTTAATAAGG + Exonic
1093551567 12:20418543-20418565 TTTTAAAAGGTGGTTTTTAAAGG + Intronic
1093606930 12:21103290-21103312 TTTTATATGGTTATTGTAAATGG + Intronic
1093682648 12:22020692-22020714 TTTTAAAGGGAATTTTAAAAAGG - Intergenic
1093760137 12:22900450-22900472 TCTTAAAAGGTTGTTTAAGTGGG + Intergenic
1093766136 12:22965181-22965203 CTTGAGATGGTTGTTTAAATAGG + Intergenic
1094186672 12:27650852-27650874 TTTCAAATGTATGTTTCAAATGG - Intronic
1094709039 12:32942734-32942756 ATTTAAAATGTTTTTTAAAAAGG - Intergenic
1095148844 12:38765558-38765580 TTTTAAATATTTTTTTAATATGG - Intronic
1095258528 12:40070665-40070687 TGTAAAATGGCTGTTCAAAAAGG - Intronic
1095449361 12:42313666-42313688 TATTAAATTGTTCTTTTAAAAGG - Intronic
1095475573 12:42584036-42584058 TTTTAAAAGGTTTCTAAAAAGGG + Intronic
1095620186 12:44244194-44244216 TTTCACATGGTTTTTCAAAATGG + Intronic
1096739446 12:53681660-53681682 CTTAGAATGGTTTTTTAAAAAGG - Intergenic
1096851479 12:54441046-54441068 TTTCAAATTTTTGTTTTAAAGGG + Intergenic
1096859475 12:54514240-54514262 TTTACAATGATTTTTTAAAATGG - Intronic
1097345274 12:58484688-58484710 TTGTATATCATTGTTTAAAAAGG + Intergenic
1097447443 12:59689598-59689620 TTTTATTTGATTTTTTAAAATGG + Intronic
1097447786 12:59694336-59694358 GTTTAAAAGTTTTTTTAAAAAGG - Intronic
1097606256 12:61758300-61758322 TTTTAAACGGATGCTTTAAAAGG + Intronic
1097713656 12:62942116-62942138 TTTTAAATGATTGGACAAAAAGG + Intergenic
1098101649 12:67024114-67024136 TTTTAACTATTTGTTAAAAAAGG - Intergenic
1098512916 12:71339950-71339972 TTTGAAATTGTTTTTTAAAAAGG + Intronic
1098716595 12:73834413-73834435 TTTTTTATGTTTGTTTTAAATGG + Intergenic
1099020305 12:77395464-77395486 TTTTATTTGTTTGTTTAAACTGG + Intergenic
1099200452 12:79670170-79670192 GTTTACATGGCTTTTTAAAATGG - Intronic
1099258525 12:80346601-80346623 TTTTAAATGGTTTTTTAATCTGG - Intronic
1099343770 12:81472329-81472351 TTTTTAATGGCTGAATAAAATGG + Intronic
1099468790 12:83021028-83021050 ATTTGAATGGTTATTTAAAATGG + Intronic
1099609449 12:84849051-84849073 TTTAAAATGGAGGTTTAAAAAGG + Intergenic
1099782649 12:87217570-87217592 TTTTAAAAGAATTTTTAAAAAGG + Intergenic
1099934933 12:89114050-89114072 TTTTAAATTGATGTTTAAAGTGG + Intergenic
1100515341 12:95322231-95322253 TTTTAAAAGGTTGAAAAAAAAGG - Intergenic
1100675656 12:96863921-96863943 TTTGGAATGATGGTTTAAAACGG - Intronic
1100784343 12:98063237-98063259 TTTTAAAGGGGCGTTTAATAAGG - Intergenic
1100799630 12:98217594-98217616 TTTTAACTGGTTGTGTTAAGAGG - Intergenic
1101198847 12:102413765-102413787 TTTTAACTGGTTGAGAAAAATGG + Intronic
1101821318 12:108186190-108186212 TTTTAAAAGTCTATTTAAAAAGG - Intronic
1101923418 12:108951730-108951752 TTTGAAATTGTTGTTCAACATGG + Intronic
1102269113 12:111515934-111515956 TCTTGAATTGTTGTTAAAAAGGG - Intronic
1103144693 12:118584871-118584893 TTTAAAGTGGCTCTTTAAAATGG - Intergenic
1103959740 12:124601696-124601718 TTTTAAAGCGATCTTTAAAAGGG - Intergenic
1104243075 12:127009946-127009968 TTTAAAATTCTTTTTTAAAATGG - Intergenic
1104444835 12:128824351-128824373 TTTTAAACAGTTTTTTGAAATGG + Intergenic
1104456900 12:128922446-128922468 TAATAAATGATTGTTAAAAATGG - Intronic
1105372640 13:19815144-19815166 AATTAACTGGTTGTTTTAAAGGG + Intergenic
1105446112 13:20458891-20458913 TTTTAAAATGTTTTTTAAAAGGG - Intronic
1105512711 13:21063994-21064016 TTTTTAATGTTTTTTAAAAAAGG - Intergenic
1105909692 13:24851527-24851549 TTCTAAATATTTGATTAAAAAGG + Exonic
1106056078 13:26238710-26238732 TTTTAAAAGATGGTTTAACAAGG - Intergenic
1106471116 13:30055206-30055228 TTCTAAATAAATGTTTAAAATGG + Intergenic
1106805308 13:33300763-33300785 TTTTAAAAGGTTGATTTAAATGG - Intronic
1106877659 13:34091690-34091712 TTTTACATGTTTTTTTAAACAGG + Intergenic
1106922943 13:34583694-34583716 ATGTAAATGGTTATTTAATATGG + Intergenic
1106993803 13:35457170-35457192 TTTTAAATGGGTCTTAAAAATGG - Intronic
1107075031 13:36314421-36314443 TTTTAAATTTTCTTTTAAAAAGG - Exonic
1107255767 13:38425160-38425182 TTTTAAATTGTTGGTAAAATAGG - Intergenic
1107374947 13:39794267-39794289 TCTCAAATTGTTTTTTAAAATGG - Intergenic
1107517309 13:41143080-41143102 TTGTGTATGGTTTTTTAAAAAGG + Intergenic
1107519050 13:41161031-41161053 GTTTAAATAGTTATTAAAAATGG + Intergenic
1107522451 13:41196651-41196673 TTTTAAGAAGTTTTTTAAAATGG - Intergenic
1107903368 13:45040272-45040294 TTTTCACTGGTTGGTTAAACTGG - Intergenic
1108093414 13:46875324-46875346 TTTTAAAAGGTCTTTAAAAATGG - Intronic
1108484857 13:50913159-50913181 TCTTAAATGTTTCTGTAAAATGG + Intronic
1108509491 13:51142842-51142864 AAGTAACTGGTTGTTTAAAAAGG + Intergenic
1109167033 13:59048291-59048313 TTTTAATGGGTTTTTTAAAGGGG + Intergenic
1109168110 13:59060878-59060900 TTTTATATGATTGGTTAAAGAGG + Intergenic
1109366328 13:61361345-61361367 TTTAAATTGGTAGTTTATAAGGG + Intergenic
1109526497 13:63582296-63582318 TTTTTAATGGCTATTTTAAATGG + Intergenic
1109672382 13:65626162-65626184 TTCTAAATTAATGTTTAAAAAGG + Intergenic
1109740561 13:66548938-66548960 TTTTTAATGTTTTGTTAAAAAGG + Intronic
1109786349 13:67180608-67180630 TTTTGAATAGTTATTTTAAATGG - Intronic
1109932717 13:69235995-69236017 TTTTGAATGGATCTTTAAAGAGG - Intergenic
1109967052 13:69714439-69714461 TTTTTAAAGTTTGTTTAAACTGG - Intronic
1110088708 13:71416688-71416710 TTTTAAGTGGGAGTTTGAAAAGG - Intergenic
1110394181 13:75010903-75010925 TTTTAAAAGGCTTTTAAAAAAGG - Intergenic
1110589702 13:77241910-77241932 TTTTAAATGCTTATTAGAAATGG - Intronic
1110679197 13:78288324-78288346 TTAAAAATAGTTTTTTAAAAAGG - Intergenic
1110795372 13:79630928-79630950 TTTTAAAATGTTGGTCAAAATGG + Intergenic
1111228746 13:85312287-85312309 TTTTTAATGGCCTTTTAAAATGG + Intergenic
1111473228 13:88713413-88713435 TTTTAATTGAATGATTAAAATGG + Intergenic
1111635690 13:90900818-90900840 ATTTAAATGATTATTTCAAAAGG - Intergenic
1111683245 13:91469577-91469599 TTTCAAAAATTTGTTTAAAATGG + Intronic
1111733905 13:92113084-92113106 TTTGAAATGGAAATTTAAAAAGG - Intronic
1111740273 13:92196419-92196441 ATTGAAATGGTTTTTTAAGAGGG + Intronic
1112189840 13:97165294-97165316 TTTATAATAGTTCTTTAAAAGGG + Intergenic
1112195315 13:97220000-97220022 TTTCAAATGGTGGTTGAAGAAGG + Intergenic
1112770149 13:102786339-102786361 TTTTATATTGTTGCTTAAACAGG - Exonic
1112791998 13:103013534-103013556 TTTGAAAAGATTTTTTAAAAAGG + Intergenic
1113031385 13:105997490-105997512 TTTTTAATGCTTTTCTAAAAAGG - Intergenic
1113032259 13:106007199-106007221 TTTTTAATGGTTTTCTGAAATGG + Intergenic
1113136583 13:107096990-107097012 TTTTAAATGGAAGATTTAAAAGG + Intergenic
1113152310 13:107278023-107278045 TTTTAAATCATTGTATAAGATGG - Intronic
1114343148 14:21766453-21766475 TTTTAAATTACTTTTTAAAATGG - Intergenic
1114711673 14:24784848-24784870 TTTTAAGGGGACGTTTAAAAGGG + Intergenic
1114920833 14:27326708-27326730 ATTTAAATACTTTTTTAAAATGG + Intergenic
1114986458 14:28235828-28235850 TTGTAAATTTTTGTTTAAAAGGG + Intergenic
1115157936 14:30361417-30361439 TTTTAATTGATTGTTAAAAGGGG + Intergenic
1115896115 14:38089414-38089436 TTGTAAGTGGTTATTTAAAAGGG + Intergenic
1115979276 14:39031077-39031099 TTTTAAATGGTGAACTAAAAGGG + Intergenic
1116195061 14:41715004-41715026 TGTTAAAGGGTTTTATAAAATGG + Intronic
1116388100 14:44357616-44357638 TTTCAGATGGCTGTTTTAAAAGG + Intergenic
1116746818 14:48830570-48830592 TTTAAAATGATCTTTTAAAAAGG - Intergenic
1116748296 14:48849297-48849319 TTTTAATTGCTTAATTAAAATGG + Intergenic
1116894688 14:50304525-50304547 TTGTAAATGGTTGTATAATCAGG - Intronic
1117262215 14:54047471-54047493 TATTAAATGGTAAGTTAAAATGG + Intergenic
1117564571 14:56979790-56979812 TTTTAATTTGTTTTTTAAAGGGG - Intergenic
1117796048 14:59395494-59395516 GTTCAAATGGTTGTTTATTAGGG - Intergenic
1117823864 14:59679527-59679549 CTTTTAATGGTTATTAAAAAGGG + Intronic
1118124798 14:62889840-62889862 TTAAAGATGGTTGTTTAAAAAGG + Intronic
1118361464 14:65060968-65060990 ATTTAAATGCGTGTTTATAATGG + Intronic
1118871189 14:69743732-69743754 AATAAAATGGTTGTTTAAGAAGG - Intronic
1119193298 14:72699216-72699238 TTTTAAAAATTTGTTTAGAAAGG + Intronic
1119585189 14:75827430-75827452 TTTTAAATGTTTATTTAAATAGG + Intronic
1119691357 14:76675247-76675269 TTTTTAATGGTTCTTATAAATGG - Intergenic
1119795242 14:77390488-77390510 TCTTAAATGGTACTTTGAAAAGG + Intronic
1119885446 14:78136720-78136742 TTTTAGATCATTGTTTAAAAAGG - Intergenic
1120473636 14:84959136-84959158 TTTTAAAGGCTTGTTTTAATGGG - Intergenic
1120728510 14:87975153-87975175 TTTTCAATGGTTTTTGAAATTGG - Intronic
1121077390 14:91080696-91080718 TTTGGGATGGTTGGTTAAAATGG - Intronic
1121147543 14:91598083-91598105 AAATAACTGGTTGTTTAAAAAGG - Intronic
1121186533 14:91976795-91976817 TTTTAAATTATTATTTAAAAAGG + Intronic
1121642776 14:95497002-95497024 TTTTATTTCTTTGTTTAAAATGG - Intergenic
1122759452 14:104011436-104011458 TATTAAACTGTTGATTAAAATGG - Intronic
1123914050 15:25003585-25003607 TTTGAAATGTTGGCTTAAAAAGG + Intergenic
1124107232 15:26751260-26751282 TTTTAAATATTTGATTAACATGG - Intronic
1124157946 15:27244604-27244626 ATTTAAATATTTATTTAAAAGGG - Intronic
1124605362 15:31166085-31166107 TTTTCAATGATTGTTTATAGTGG + Intergenic
1124659274 15:31532115-31532137 TTTTTTTTGTTTGTTTAAAAGGG - Intronic
1125234305 15:37494516-37494538 ATTTAAATGCTTATTAAAAATGG - Intergenic
1125436319 15:39648887-39648909 TTTTATATCATTATTTAAAAAGG + Intronic
1125809801 15:42528532-42528554 TTTTAAATGCATTTTAAAAATGG - Intronic
1125994541 15:44145311-44145333 TTTTAAGTGGTTGTGTTAACAGG - Intronic
1126261378 15:46696762-46696784 GTTTAAATGGATATTTAAAGTGG - Intergenic
1126712941 15:51481987-51482009 TTTTAATTGATTCCTTAAAAGGG + Intronic
1126736251 15:51734722-51734744 ATTTAAATGATTGTTTTAAAAGG - Intronic
1127002500 15:54526192-54526214 TTTTAAATGTTTGTTAAAACTGG + Intronic
1127039417 15:54957445-54957467 TTTGAAATAGTTATTTAGAAGGG + Intergenic
1127059206 15:55164770-55164792 TTTTAAATGATTGTTTTCCATGG + Intergenic
1127208871 15:56750149-56750171 TTTCACAAGTTTGTTTAAAATGG - Intronic
1127217912 15:56844327-56844349 TTTCAAATGGCTCATTAAAAAGG + Intronic
1127225657 15:56925732-56925754 TATTAAATGATCTTTTAAAAAGG - Intronic
1127967421 15:63932991-63933013 GTTTCAATAATTGTTTAAAATGG - Intronic
1128467624 15:67926206-67926228 ATTTAAATGGTTGGTTTAAGTGG + Intergenic
1128829849 15:70758094-70758116 TTTTAATTAGTTTTTTAATAAGG - Intronic
1128856019 15:71016232-71016254 TTTTAAATGCTTTTTTAAAAAGG - Intronic
1129899376 15:79134332-79134354 TTTAAAATGGTTTTTTAAAATGG - Intergenic
1130351986 15:83100882-83100904 TTGTATATGGCTTTTTAAAAAGG - Intergenic
1131134372 15:89922153-89922175 TTTTAAAGGATTGTTAAATATGG + Intergenic
1131462157 15:92625031-92625053 TTTGAAATGGTTCTTTCAAGAGG - Intronic
1131688080 15:94792929-94792951 TTTTACATGGTTTTATAGAAAGG - Intergenic
1131781229 15:95862175-95862197 TTTTACATGGTTGAGTCAAATGG + Intergenic
1131907781 15:97163076-97163098 AATTAAATGGTTTCTTAAAAAGG - Intergenic
1132535245 16:475859-475881 TTTTAAATTGTTTTTTGAGATGG + Intronic
1133098288 16:3462899-3462921 TTTTAAATGTTTTTTTGAAATGG + Intronic
1133135613 16:3709129-3709151 TTTTTAAAAGTTATTTAAAAGGG + Intronic
1133502880 16:6382179-6382201 TTTTAAATGGTTGGGGAAAAAGG - Intronic
1133934961 16:10261469-10261491 TTTTATATCTTGGTTTAAAAAGG + Intergenic
1134116867 16:11555486-11555508 TTTTAAATTTTTGTGTAAATCGG - Intronic
1134236821 16:12472960-12472982 TTTTTATTGCTTGTTTTAAAAGG + Intronic
1135086215 16:19476455-19476477 TTTTAAAAGTTTGTATAGAAGGG + Intronic
1135754499 16:25085617-25085639 ATTTACATGATTGATTAAAAGGG + Intergenic
1135867843 16:26121071-26121093 TGTAAAATTGTTGTATAAAATGG + Intronic
1136505650 16:30701323-30701345 TTTTAAATTTTTCTATAAAAAGG + Intronic
1136706264 16:32190425-32190447 TTTTAAAAACTTGTTTAAATAGG + Intergenic
1136761646 16:32738986-32739008 TTTTAAAAACTTGTTTAAATAGG - Intergenic
1136806454 16:33131404-33131426 TTTTAAAAACTTGTTTAAATAGG + Intergenic
1137784715 16:51128726-51128748 TTTTAAATTATTATTTAAACAGG + Intergenic
1137964489 16:52916984-52917006 TTTTGAATGGTTATGGAAAATGG - Intergenic
1138057486 16:53850454-53850476 TTTTAAATTTTTATTTAATAGGG + Intronic
1138065267 16:53934401-53934423 TTTTACACTGTTGATTAAAAAGG - Intronic
1138158852 16:54733927-54733949 TTTTGACTGTTTGTTTAGAAGGG - Intergenic
1138299965 16:55917808-55917830 TTTTATATGTATGTTTAAGATGG - Intronic
1138669475 16:58601562-58601584 TTTTAAATGGCCTTTTAAAGGGG - Intronic
1138808258 16:60118976-60118998 TTTTAAATATTTTTTTAAATGGG + Intergenic
1140017550 16:71202780-71202802 TTTTAATAGATTGTTTAAAAGGG - Intronic
1140041262 16:71409835-71409857 TTTAAAAAGATTTTTTAAAATGG - Intergenic
1140499285 16:75419293-75419315 TTTTAAATAGCAGTCTAAAATGG - Intronic
1140538630 16:75734224-75734246 TTTTTAATGCATGTTTTAAACGG + Intronic
1140606459 16:76545085-76545107 TTTTAAAAGCATGTTTTAAAAGG + Intronic
1140614337 16:76642576-76642598 TTTTAATTTATTGTTTAAAGGGG + Intergenic
1140780113 16:78288177-78288199 TTTTAAATTTTTATTTAATATGG + Intronic
1140927095 16:79593718-79593740 TATTACATGGTTTTTGAAAAGGG + Intronic
1141944667 16:87301292-87301314 TTTTAAATTGTTGTGAAATACGG - Intronic
1203063803 16_KI270728v1_random:999299-999321 TTTTAAAAACTTGTTTAAATAGG - Intergenic
1143287331 17:5800089-5800111 TTTTAAATGGTTGCAACAAAAGG - Intronic
1143578358 17:7808479-7808501 TTTTAAATGATTGATTTAATAGG + Intronic
1146092497 17:29893845-29893867 TTTAAGATAGTTCTTTAAAAGGG - Intronic
1146158075 17:30541072-30541094 TTTTAAACTGTTTTTTAACAGGG + Intergenic
1146180396 17:30694306-30694328 TTTTTAATTTTTTTTTAAAAAGG - Intergenic
1146209400 17:30930378-30930400 TTTTTAATGCTGGTTTAAACTGG - Intronic
1146547598 17:33752197-33752219 TTTTAAATTTCTGTTTGAAAGGG - Intronic
1147010453 17:37442457-37442479 TTTAAAATGGTTTTTATAAAAGG - Intronic
1147972141 17:44224191-44224213 TTTTAAATTTTTATTTAAGATGG + Intergenic
1148202613 17:45759615-45759637 TTTTTAAAAATTGTTTAAAAAGG + Intergenic
1148403669 17:47390762-47390784 TTTTAAATTGTTGAATTAAATGG + Intronic
1148901603 17:50882871-50882893 CTGTAAATGGTTGGCTAAAATGG + Intergenic
1149030287 17:52074866-52074888 TTTTAAATGGTTGAAAAAAAAGG + Intronic
1149208781 17:54279696-54279718 CTTAAAATGGATTTTTAAAAGGG - Intergenic
1149744649 17:59084561-59084583 TTTTAAATGTTCTTTTAAACTGG + Intronic
1149774854 17:59349235-59349257 TTTAAAATTTTTGCTTAAAAGGG + Intronic
1150342970 17:64383698-64383720 TTTAAAATTGTTTTTTAAAAAGG - Intronic
1151147072 17:72051014-72051036 TGTTAAATGGCTACTTAAAAAGG - Intergenic
1151298705 17:73205293-73205315 CTGTAAATGGTTGTTCTAAAGGG - Intronic
1151772151 17:76170866-76170888 TTTTAAAAATTTCTTTAAAAAGG - Intronic
1153005416 18:494417-494439 GATTAAATAGTTGTTTAGAATGG - Intronic
1153117052 18:1671164-1671186 TTTTAAAAGATTTTTTAAAATGG - Intergenic
1153429123 18:4996219-4996241 TTTGAAAAGGTTGATAAAAATGG + Intergenic
1153741466 18:8133771-8133793 TTCTAAATGATTATTTCAAAAGG - Intronic
1154277996 18:12979027-12979049 TTTGAAATGTTTTTTAAAAATGG + Intronic
1154967530 18:21374711-21374733 TTTTAAAAGTATTTTTAAAAAGG - Intronic
1155288518 18:24316961-24316983 TTTTAAAATTTTGTTCAAAATGG + Intronic
1155390523 18:25330788-25330810 TTTAAAATACTTGTTTTAAAAGG + Intronic
1155396180 18:25388756-25388778 TTCTAAATTGTTCTTCAAAAAGG - Intergenic
1155405521 18:25482836-25482858 TTTTAAAAGTTATTTTAAAAAGG - Intergenic
1155731061 18:29159003-29159025 TTTTAAATAGTTTACTAAAATGG - Intergenic
1155847394 18:30726219-30726241 CTTTAAATATTTGTATAAAAAGG + Intergenic
1155940936 18:31801452-31801474 ATTGAGATGGTTTTTTAAAATGG + Intergenic
1156249345 18:35336791-35336813 TTTTAAAAGATGGTTTAAAATGG + Exonic
1156611525 18:38730597-38730619 TTTTAAATTTTTTTTTAAGATGG + Intergenic
1156693535 18:39737578-39737600 TCTTAAAAGGTTTTTTATAAAGG + Intergenic
1156870266 18:41937600-41937622 TTTTAAACTGTAGATTAAAAAGG + Intergenic
1157012042 18:43661492-43661514 TTCTAAATGGCTGCATAAAAAGG + Intergenic
1157041067 18:44039652-44039674 TTTTGAAGGGGTGGTTAAAACGG - Intergenic
1157266887 18:46232360-46232382 ATTTAAATAATTTTTTAAAAGGG - Intronic
1157348904 18:46867658-46867680 TTATGAAGGGTTGTTGAAAAAGG - Intronic
1158353678 18:56592459-56592481 TTTAAAAGTGTTTTTTAAAAGGG + Intergenic
1158663520 18:59411297-59411319 TTTTAAATGTTTGTTGGGAAAGG + Intergenic
1159397582 18:67883123-67883145 TTTTAAACGATTGTTGTAAAGGG + Intergenic
1159448471 18:68569326-68569348 TTTATAATGGTTGTTTATAATGG + Intergenic
1159565919 18:70049659-70049681 TTTAAGTAGGTTGTTTAAAAAGG + Intronic
1159762084 18:72439831-72439853 TGTTAAAGGATTTTTTAAAAAGG - Intergenic
1160146005 18:76365203-76365225 TTCTAAATGTTATTTTAAAATGG - Intronic
1161754894 19:6125386-6125408 TTTTAAAGGCTTGTAGAAAATGG - Intronic
1162830409 19:13281205-13281227 TTTTAAATGCTTGTAGAAACGGG - Intronic
1163499630 19:17668489-17668511 TTTTAAATTGTTTTTTGAGACGG + Intronic
1163776101 19:19218822-19218844 TTTTAAAAAATTTTTTAAAAGGG - Intronic
1163812935 19:19445389-19445411 TTTTACATGCTTTTTTAAAGAGG - Intronic
1163869908 19:19812013-19812035 TTTTAAATGGCTATATGAAATGG + Intronic
1164114667 19:22207911-22207933 TTTTATATGGTGTTATAAAAGGG - Intergenic
1164215739 19:23144921-23144943 TTTTAACTTGTCTTTTAAAAAGG + Intronic
1164220766 19:23191489-23191511 GTATAAATGGATTTTTAAAATGG + Intergenic
1164448953 19:28342991-28343013 TTTTAAATTGTTCTTCAAAGAGG - Intergenic
1164664340 19:30015436-30015458 TTTTAAAATTTTCTTTAAAATGG - Exonic
1166057212 19:40298337-40298359 TTATAAATAGCTCTTTAAAACGG + Intergenic
1167087033 19:47317336-47317358 TTTTTAATGTTTTTTTAAAGAGG - Intronic
1167469849 19:49669610-49669632 TTTTAATTGATTGTTTAGAGGGG + Intronic
925080479 2:1059747-1059769 TTCTAGATTGTTTTTTAAAATGG - Intronic
925474243 2:4194813-4194835 TTTCAAATGAATTTTTAAAATGG + Intergenic
925582750 2:5428450-5428472 GTTTATATGGGTGTTTACAATGG - Intergenic
925938554 2:8792181-8792203 TTAAAAATCTTTGTTTAAAAAGG + Intronic
926260305 2:11254170-11254192 TTTTTGATGGTTGTTTACAATGG - Intronic
926451197 2:13006431-13006453 TTTTAAATTCTGATTTAAAAGGG - Intergenic
926505601 2:13711262-13711284 CTTTAAATGTGTTTTTAAAAAGG + Intergenic
926945251 2:18180480-18180502 TTTTATTTGGTTGTTCTAAAAGG + Intronic
927535018 2:23849032-23849054 TTTCAAAGTGTTTTTTAAAAAGG + Intronic
927837811 2:26414905-26414927 CTTGAGATGGTTGTTGAAAATGG - Intronic
928528978 2:32171266-32171288 TTGTATATGTTTGTTTGAAAGGG + Exonic
928872299 2:35994685-35994707 TTATACATGGTTCTTTAACATGG + Intergenic
929179404 2:39018794-39018816 TTTTAAATGGCTGCATTAAAGGG - Intronic
929185009 2:39084803-39084825 TTTTAAAAAGTTGTTTAGGAAGG - Intronic
929349420 2:40930722-40930744 TTTTAAATGTTTCTTCAAATGGG + Intergenic
929473787 2:42224077-42224099 TTTTAAATGGGTGATTCATATGG - Intronic
929544278 2:42845660-42845682 TTTTAAGAGGTTGTTGAAAGCGG + Intergenic
929986741 2:46741481-46741503 TTTTAAAATGTTATTTAAAAAGG - Intronic
930422670 2:51174220-51174242 ATTTAAATAGATATTTAAAAGGG - Intergenic
930744701 2:54870316-54870338 TTTTAAATTTTTTTTTAAAAGGG + Intronic
930744722 2:54870439-54870461 TTTTAAATTGTTTTTTAAAAGGG + Intronic
931332077 2:61297996-61298018 TTTTTAATGGTTATTTACAACGG - Intronic
931388871 2:61822488-61822510 GTTTTAGTGGTTGTTTAGAAGGG - Intergenic
931430953 2:62208687-62208709 TTTAAAATGTTTGATCAAAATGG + Intronic
931880585 2:66565924-66565946 TTTTAATTGGTTATTTCACATGG + Intronic
931915828 2:66955257-66955279 TTTTAAAATTTTTTTTAAAAAGG + Intergenic
932105380 2:68936813-68936835 TTTTAAAATGATTTTTAAAAAGG - Intergenic
932190889 2:69741081-69741103 TTTTAAAAGGTGGTTTAATATGG - Intronic
932529260 2:72509452-72509474 TTTTTTATGGTTGTAGAAAAAGG + Intronic
932542993 2:72676268-72676290 TTTCAAATTATTTTTTAAAAAGG + Intronic
932640155 2:73437615-73437637 TTTTAATTATTTGGTTAAAATGG + Intronic
932767231 2:74478646-74478668 TTTTAAAAAGATTTTTAAAAAGG + Intronic
932898093 2:75664084-75664106 TTTTCAATGCATTTTTAAAAAGG + Exonic
933076515 2:77934218-77934240 TTTTGAATGTTCTTTTAAAATGG - Intergenic
933201823 2:79459887-79459909 TTTTAGACTGTTGTTTAAAAAGG - Intronic
933292180 2:80450318-80450340 TAATAAATGGTCCTTTAAAAAGG - Intronic
934458626 2:94197323-94197345 TTTTAAATTGGTGTTAAGAAAGG - Intergenic
935422609 2:102885601-102885623 TTTTAAATTGTTATTTAATGTGG - Intergenic
935510045 2:103960084-103960106 TTTTAAATGAAAGATTAAAAAGG - Intergenic
935792290 2:106603837-106603859 TTTTAAAGTGATGATTAAAAAGG - Intergenic
935963685 2:108451148-108451170 TCTTTAATCGTGGTTTAAAATGG + Intronic
936710563 2:115125889-115125911 ATTTAAATACATGTTTAAAAAGG - Intronic
937076450 2:119110917-119110939 TTTTAAATTGTGCTTTACAATGG - Intergenic
937457681 2:122056938-122056960 ATTTAAAAAGTTATTTAAAAGGG + Intergenic
937837047 2:126481991-126482013 TTTTAAATGTTTCTTAACAATGG - Intergenic
937902865 2:127035761-127035783 TATTAAATTGTAGGTTAAAAAGG - Intergenic
937945167 2:127327705-127327727 TTTTAATTGTTTTTATAAAAGGG - Intronic
938683509 2:133715282-133715304 TTTTTCATATTTGTTTAAAATGG - Intergenic
938729117 2:134132239-134132261 ATTTTAATGGTTTTCTAAAAAGG - Intronic
939257484 2:139763236-139763258 TTTTAAATGATTGTTTACTGGGG + Intergenic
939272879 2:139962525-139962547 TTTAAAATGGTCATATAAAAAGG - Intergenic
939854585 2:147342966-147342988 TTTTAAAAGGTATTTTAAAAGGG + Intergenic
939930066 2:148222955-148222977 TTTTTAATGGTGGATTATAAAGG + Intronic
940031763 2:149271324-149271346 TTTTAATTATTTGTTAAAAATGG + Intergenic
940078244 2:149768598-149768620 GTTTAAATCATTTTTTAAAAAGG + Intergenic
940561968 2:155309432-155309454 TTTTTAATTTTTGTTTGAAAGGG - Intergenic
940576346 2:155509223-155509245 ATTTAATTGGTTATTTACAAAGG + Intergenic
940921812 2:159316118-159316140 TTTTAAGTGGTTGTATATAGGGG + Intergenic
941038913 2:160598588-160598610 TTTTAATTGGCTGTTAAAAGAGG + Intergenic
941096123 2:161240128-161240150 TTTAAATTGATTTTTTAAAAAGG - Intergenic
941217114 2:162726033-162726055 TTTTAAAAAATTGTTTAAATTGG + Intronic
941389735 2:164897130-164897152 TTTTAAATGATTTTTTAATGAGG - Intronic
941412459 2:165176749-165176771 TTTTAAATGCTTTTAAAAAATGG - Intronic
941817063 2:169806444-169806466 TTTTAAATAGTTTTTTATTACGG + Intronic
942022094 2:171875947-171875969 TTTTAAATGTTAGATTCAAAAGG - Intronic
942994091 2:182239822-182239844 TTTTAAACAGTTGTTCACAAAGG + Intronic
943020743 2:182570399-182570421 TTGTAAATGACTGTTGAAAAAGG + Intergenic
943055966 2:182980195-182980217 TTTTCTATGGTCATTTAAAAAGG - Intronic
943205078 2:184884541-184884563 TTTTACAGTGTAGTTTAAAAAGG - Intronic
943471306 2:188297088-188297110 TTTTAATTAGTTGTTAAAATTGG - Intronic
943596191 2:189860064-189860086 TCTTAAATGGTTTTTTTAACTGG + Intronic
943616077 2:190094244-190094266 TTTTAAAGGTTTTTTTAAAAAGG + Intronic
943807992 2:192147625-192147647 TTTTTAACGTTTGTTGAAAATGG - Intronic
944086019 2:195848906-195848928 TTTTTAACTGTTATTTAAAATGG + Intronic
944136202 2:196402395-196402417 TTTGAAATAGTTGTCTAACATGG + Intronic
944374175 2:199021488-199021510 TTTTAAAGGGTCATTCAAAAAGG + Intergenic
944404642 2:199369803-199369825 TTTTAAATGGGAGTTTATGAAGG - Intronic
944679945 2:202068105-202068127 TTTTAAATTTTTTTTTAAACAGG + Intergenic
944965589 2:204928462-204928484 TGTTAAATTGATGTTTAAAATGG - Intronic
945037092 2:205713593-205713615 TTTTAAAAGTATGTTTTAAAAGG - Intronic
945451699 2:210002236-210002258 TTTTTAATTGTTGTTTTAAAGGG + Intergenic
945591343 2:211735747-211735769 TTTTAAATGGTTTCCTCAAAAGG - Intronic
945777299 2:214122414-214122436 TTATCACTGGTTTTTTAAAAAGG - Intronic
946255584 2:218439375-218439397 TTTTAAATCTTATTTTAAAAAGG + Intronic
946981941 2:225227795-225227817 TTTTAAAGCGATATTTAAAAGGG - Intergenic
947066611 2:226233769-226233791 TTTTAAATAGATTTTTAAAAGGG - Intergenic
947093311 2:226537979-226538001 TTATAAAGGGCAGTTTAAAAGGG - Intergenic
947318413 2:228890196-228890218 TTTTAAATGCCTGTTTACCAAGG + Intronic
947434047 2:230057453-230057475 TTTTAAAAAATTGTTTAACATGG - Intronic
948078747 2:235188280-235188302 TTTTAAAGGGTTTTTTAAAAGGG - Intergenic
948150218 2:235738931-235738953 TTTTAAAAAGTTTTTTTAAAGGG + Intronic
1169580567 20:7019033-7019055 TTTTAAAAGCTTCTTTAAATAGG - Intergenic
1169766583 20:9153653-9153675 TTGTAATTGGATGTTTAAAGAGG + Intronic
1169886125 20:10399840-10399862 TTTTAAATATTAGTTTTAAAAGG - Intergenic
1169955102 20:11093603-11093625 TGTTAAATTGATCTTTAAAATGG - Intergenic
1172417501 20:34782909-34782931 CCTTTAATAGTTGTTTAAAATGG - Intronic
1172473250 20:35216701-35216723 TTTTAATTTTTTTTTTAAAATGG - Intergenic
1173232860 20:41214952-41214974 TTGTAAATGGATCTTTAAATGGG + Intronic
1173859216 20:46271155-46271177 TGATAAATGGATGTTTACAATGG - Intronic
1174101112 20:48126910-48126932 TTTTTAAAGGTTATTTCAAATGG - Intergenic
1174734094 20:52948000-52948022 TTTTAAATTACTTTTTAAAATGG - Intergenic
1174921568 20:54708487-54708509 TTTCAAATGACTGTTTAACAAGG + Intergenic
1176895219 21:14369431-14369453 TTTTAATTGGTTGATTGAGATGG - Intergenic
1177049348 21:16212440-16212462 TTTTTAATGAGTTTTTAAAAAGG - Intergenic
1177053929 21:16275826-16275848 TTATAAATGGATGTTTAAGGAGG - Intergenic
1177593570 21:23205917-23205939 TTCTAATTTGTTGTTTCAAATGG - Intergenic
1177711812 21:24785510-24785532 TTTCAAATACTTGTCTAAAATGG + Intergenic
1177866253 21:26516588-26516610 TTTTAATTGTCTGTTTAAATAGG + Intronic
1178292461 21:31380611-31380633 TTTTAAATGGATGATTCGAAAGG + Intronic
1178366744 21:31994704-31994726 TATTAAAATGTTTTTTAAAAGGG - Intronic
1178549343 21:33522597-33522619 TTTTAAATGATTTTTTATTAAGG + Intronic
1178905922 21:36636123-36636145 TCTTAAATGTTTGTTCACAAAGG + Intergenic
1180028628 21:45185160-45185182 ATTCAAATGGTTGTGGAAAAGGG - Intronic
1180156535 21:45980321-45980343 TTTCAAATGTTTCTTTAACATGG + Intergenic
1180239516 21:46491408-46491430 TTTTAAATGTTTTTTCAACAGGG + Intronic
1180409576 22:12592251-12592273 TTTTTAATAGTTATTTTAAATGG - Intergenic
1181364709 22:22366883-22366905 TGTTAAATGGGTGTTTTAAAAGG - Intergenic
1183005493 22:34898099-34898121 TTTTAAATGCTTATTTATACTGG + Intergenic
1185123849 22:48992989-48993011 TTTTAAATGATTTTTTTTAAAGG + Intergenic
1185186376 22:49403150-49403172 TTTTAAAGGTTTCTCTAAAATGG - Intergenic
949230200 3:1742010-1742032 TTTTAAATGCTTGCCAAAAATGG - Intergenic
949659711 3:6264331-6264353 TTTTAAATAGCTGTTAGAAACGG + Intergenic
950069526 3:10141383-10141405 TTTTTATTTGTTGTTTGAAACGG - Exonic
950352374 3:12368807-12368829 TTTTAAATGCTTGAGTCAAAAGG + Intronic
950946265 3:16950351-16950373 TTTTAAATTGTTATTTTGAATGG + Intronic
950969562 3:17172823-17172845 TTTTAAATGGCTGGTGCAAAAGG + Intronic
950986655 3:17377904-17377926 TTTTCAAGGTTTGTTTAATAAGG - Intronic
951151400 3:19294833-19294855 TTTTAAATTTTTCTTTCAAATGG - Intronic
951155570 3:19349263-19349285 TTTTAAATTCTTGTTCAAACTGG - Intronic
951335647 3:21418485-21418507 GTTTAAATGGTCTTTTAAATTGG - Exonic
951457632 3:22910471-22910493 TGTTACATGGTTATTTTAAAAGG - Intergenic
951714788 3:25628991-25629013 TTTTATATTGTTGTCTTAAAGGG - Intronic
951738129 3:25890320-25890342 TTTTAACTAGTTGTTTACATAGG - Intergenic
951779070 3:26342370-26342392 TTTTAAATTATTGTTTAAAGGGG + Intergenic
951785591 3:26415224-26415246 CTTTTGATGTTTGTTTAAAAAGG - Intergenic
951863319 3:27278072-27278094 TTTTAAATGCTTGTTGAAAAAGG - Intronic
952480758 3:33759408-33759430 TTTAAAATTGTATTTTAAAAGGG - Intergenic
952727883 3:36607551-36607573 TTTTAAATGGTGTTGCAAAACGG - Intergenic
952806388 3:37357913-37357935 TTTTAAATGTATGCTTCAAATGG + Intronic
953010759 3:39023284-39023306 TTTTAAATGCTTTTTTATTATGG - Intergenic
953526621 3:43695474-43695496 TATTAAAATTTTGTTTAAAATGG - Intronic
954005485 3:47587243-47587265 TTTTAAAGGGTTTTTTAAAGAGG + Exonic
954194251 3:48986976-48986998 TTTTAAATGGCTGTGTAATGTGG - Intergenic
954880095 3:53829548-53829570 TTTTAAAATACTGTTTAAAAAGG - Intronic
955262317 3:57405688-57405710 TGTGAAATGATTCTTTAAAATGG + Intronic
955264678 3:57430233-57430255 TTTAAACTGTTTTTTTAAAAAGG - Intronic
956204211 3:66739030-66739052 TTTTAAATGGTGGATAAGAACGG - Intergenic
956268132 3:67421238-67421260 CTTTAAATGGGTCTTTAAAATGG - Intronic
956338312 3:68190359-68190381 TTTTAAGTGTTTCTTGAAAATGG + Intronic
956392933 3:68793667-68793689 TTTGAGCTGGTTTTTTAAAAAGG + Intronic
956599303 3:71002122-71002144 TTTTACTTAGTTGTTTCAAAGGG - Intronic
956722284 3:72128702-72128724 TTTTAAAAAGATTTTTAAAAGGG + Intergenic
956948174 3:74248416-74248438 TTCTAGATTTTTGTTTAAAATGG + Intergenic
957021290 3:75130924-75130946 TTATAAAAGATTATTTAAAAAGG + Intergenic
957136711 3:76297731-76297753 TTTTTAATGTTTGTTTCAAGTGG - Intronic
957544334 3:81617436-81617458 TTTCAAATGGGTGTTTAATTTGG + Intronic
957642358 3:82872297-82872319 TATTAGATGGTTTTCTAAAAAGG - Intergenic
957742240 3:84285945-84285967 TTTTAGATGTTTCTTTCAAACGG + Intergenic
957783952 3:84856037-84856059 TTTTAAGCATTTGTTTAAAATGG - Intergenic
958056131 3:88414592-88414614 TTTTAACAGGATTTTTAAAAAGG + Intergenic
958103998 3:89049485-89049507 ATTCAAATAGTTATTTAAAAAGG + Intergenic
958559181 3:95721329-95721351 ATTTAAATGTTTATCTAAAAGGG + Intergenic
958809240 3:98840665-98840687 TTTTAAATTGTTGGTAAAGATGG + Intronic
958900748 3:99883556-99883578 TGTGATATGGTTGTCTAAAATGG - Intronic
959307313 3:104684665-104684687 TTTTAACTGATTTTTTAAAGTGG + Intergenic
959421954 3:106139104-106139126 ATTTCTATGTTTGTTTAAAAAGG + Intergenic
959645319 3:108692802-108692824 TTTTAAATGATTGGACAAAAAGG - Intronic
959994693 3:112667941-112667963 ATTTACATGTTTGTATAAAATGG - Intergenic
960231468 3:115232753-115232775 TTTTAAATGGTTATAAATAATGG + Intergenic
960383714 3:116994421-116994443 TTTGAGATTGTTATTTAAAATGG + Intronic
960498281 3:118403389-118403411 TTATAACTGATTGTATAAAATGG + Intergenic
960737571 3:120797427-120797449 TTTTAAATTTTTTTTTACAATGG - Intergenic
960857053 3:122112556-122112578 GTTTAAATGTTGGTTAAAAACGG - Intronic
961255589 3:125548545-125548567 GTTTAAAAGGTTTTATAAAAAGG + Intronic
961385649 3:126521912-126521934 ATTTAAATGGTTGTCTTAAGCGG + Intergenic
961926626 3:130488214-130488236 TTTTAAAGGCTTTTTTAAAAAGG - Intergenic
962102324 3:132355861-132355883 TTTTAAAGTGATGTTTTAAAAGG + Intronic
962486606 3:135849484-135849506 ATTTAAAATGATGTTTAAAATGG + Intergenic
962663677 3:137631892-137631914 TTTTAAATTTATGTTTAAGATGG - Intergenic
962721457 3:138178939-138178961 TTTTAATTAGTTTTTTTAAATGG - Intergenic
963095504 3:141534620-141534642 TTTTAAATGTCTTTTTAAACAGG - Intronic
963336421 3:143979222-143979244 TTAAAAATAGTAGTTTAAAAGGG + Intronic
963561454 3:146871101-146871123 TTTTATATGGTTATTGTAAATGG + Intergenic
963631897 3:147743633-147743655 TTATATGTGGTGGTTTAAAATGG + Intergenic
963741010 3:149081622-149081644 TTTTAAAAACTTTTTTAAAAAGG - Intronic
964060982 3:152522452-152522474 CTTTAAATGGTGGTTAAACATGG + Intergenic
964061844 3:152534648-152534670 TTTAAAATGCTTTTGTAAAATGG + Intergenic
964218429 3:154316367-154316389 TTATAAATGCTTGTTGGAAAAGG - Intronic
964576748 3:158178891-158178913 TTTTAAATTGTCGTTGCAAATGG + Intronic
964585660 3:158297137-158297159 TTATAATTTCTTGTTTAAAAAGG + Intronic
964594324 3:158406566-158406588 TTTTAATTTTTTGTTTAGAAGGG + Intronic
964698908 3:159541343-159541365 TCTAAAATGGTTTTTAAAAAGGG + Intronic
964869500 3:161297778-161297800 TTTTAAGTGGTTATATAAAATGG - Intergenic
964895350 3:161589530-161589552 TTTTAAATAGTCTTTTATAATGG - Intergenic
965220364 3:165919756-165919778 ATATAAATGGTTGTTTTAAGCGG - Intergenic
965278909 3:166723338-166723360 TTTAAAATGATTTTTTAAAGAGG - Intergenic
965878295 3:173355142-173355164 TTAAAAATGGTATTTTAAAAAGG + Intergenic
966187574 3:177241649-177241671 TTTTAATTGCTTCTTAAAAATGG - Intergenic
966474437 3:180327501-180327523 TATTAATTGGCTGCTTAAAATGG - Intergenic
966546327 3:181153237-181153259 TTTTTAAAAGTTTTTTAAAAAGG + Intergenic
966646961 3:182256731-182256753 TTTTATTTGGTTATATAAAAGGG + Intergenic
967115936 3:186338648-186338670 TTTTTAATTCTTTTTTAAAAAGG + Intronic
967340861 3:188396419-188396441 TTGTAAATGGATATCTAAAATGG + Intronic
967407231 3:189130749-189130771 TTTTAAATAGTACTTTCAAATGG - Intronic
967451147 3:189624739-189624761 TTTTTCATGGTTGGTAAAAAGGG + Intergenic
967493072 3:190115402-190115424 TTTTAAATGGTTGGGAAAAGTGG + Intronic
967784569 3:193477543-193477565 TTTTATATGGTTGTTTCCAGTGG - Intronic
967832705 3:193934200-193934222 TTTAAAAAGGTGTTTTAAAAAGG + Intergenic
967902760 3:194473549-194473571 TGTCAATTGGTTTTTTAAAAAGG - Intronic
968174173 3:196534771-196534793 TTTTAAATGGTTCTTTGAAAAGG + Intergenic
968420294 4:478600-478622 ATATAAATGGATTTTTAAAATGG - Intronic
970179862 4:13379904-13379926 TTTTAAGTGGTACTTTGAAATGG - Intronic
970437060 4:16045970-16045992 TTTGAATTGGTGGTTTAAACTGG - Intronic
970806713 4:20044938-20044960 TTGTAAATGATTATTTAAAATGG - Intergenic
970870184 4:20807929-20807951 TTTTAAATTGTCTTTTAAAAGGG - Intronic
971415202 4:26420299-26420321 TTTTAAATGGTCTTTTAAAGAGG + Intronic
971456148 4:26846219-26846241 TTTTTAATGGCTGTGTAAAATGG + Intergenic
971584638 4:28389495-28389517 TTTTAAATAGTCATTGAAAAAGG - Intronic
971584639 4:28389498-28389520 TTTTCAATGACTATTTAAAATGG + Intronic
971615893 4:28790224-28790246 TTTTAAATGATAGATCAAAATGG - Intergenic
971673875 4:29598800-29598822 TTTTCTATAGTAGTTTAAAATGG + Intergenic
971771305 4:30900297-30900319 TTTTAAATTGCTGTTGAAATGGG + Intronic
971875617 4:32304510-32304532 TCTTAAATGCTTGTCTGAAAAGG - Intergenic
971925209 4:33000526-33000548 TTTTATATGTTTGTTATAAAAGG + Intergenic
971933398 4:33116334-33116356 TTTTAACAGATTGTTGAAAAGGG + Intergenic
972082436 4:35170846-35170868 TGATATCTGGTTGTTTAAAAGGG + Intergenic
972099083 4:35390070-35390092 ATTTAAAAGATTTTTTAAAAAGG + Intergenic
972360386 4:38320948-38320970 TTTTGTTTGTTTGTTTAAAATGG + Intergenic
972772993 4:42215490-42215512 TTTTAAAGGTTTTTTTAGAAGGG - Intergenic
972797258 4:42434338-42434360 TTTTAAAGATTTTTTTAAAAAGG - Intronic
972853591 4:43079299-43079321 AAATAACTGGTTGTTTAAAAAGG - Intergenic
973256532 4:48118899-48118921 TTTGAAAGGGTTATTTATAAAGG + Intronic
973272519 4:48276139-48276161 ATGAAAATGTTTGTTTAAAAGGG - Intergenic
973843134 4:54883091-54883113 TTTTACATGAATGTTTATAATGG - Intergenic
973970595 4:56210319-56210341 TTTTAAATTGTTGCTAAAACAGG - Intronic
973997276 4:56471459-56471481 TCTTAAATGTTTATTTCAAAAGG + Intronic
974093101 4:57333154-57333176 TTTTAAAATGATGTTTTAAATGG - Intergenic
974388910 4:61239131-61239153 TTTTAATTTTTTGTTTTAAATGG + Intronic
974859069 4:67497371-67497393 TTTTAAATTTTTTTTTAAGACGG - Intronic
975770629 4:77718140-77718162 TTTGAGATGTTTGTATAAAATGG - Exonic
975794009 4:77986902-77986924 TTTTAAATGCTTGGTTAAAGAGG + Intergenic
975804673 4:78099442-78099464 TTTTAAATGGTTGACCAAAAAGG - Intronic
976243559 4:82985361-82985383 TATTTAATGGATTTTTAAAATGG - Intronic
976296170 4:83474395-83474417 TTTTAAAGGGTTGTAAGAAAAGG - Intronic
976320966 4:83714959-83714981 TTTTAAAAGGTATTTTGAAAGGG + Intergenic
976551792 4:86404625-86404647 TTTCAAAAGGGTGCTTAAAATGG - Intronic
976797381 4:88949489-88949511 TTTAAAATGGTTGTTAAACCTGG - Intronic
976947421 4:90787477-90787499 TTTTTAATGGTTGTTTACTTAGG + Intronic
976950500 4:90823322-90823344 TTTTAAATGGAAGTTTAACTAGG + Intronic
977115526 4:93020570-93020592 TTTAAAATGTGGGTTTAAAATGG + Intronic
977213866 4:94255477-94255499 TTTTCAAATGTTGTTTTAAAAGG - Intronic
977403694 4:96568495-96568517 TTTTAACTGGTTATTTTAGAAGG - Intergenic
977892055 4:102323641-102323663 ATTTAAGTGGTTGATTAAAGAGG - Intronic
978032303 4:103950024-103950046 AAATAACTGGTTGTTTAAAAAGG + Intergenic
978171192 4:105672241-105672263 TTTTAAAAGTCTGTTTAAAAAGG - Intronic
978181963 4:105809213-105809235 TTTTAAGTGTTTGGTTAAGATGG + Intronic
978363163 4:107952295-107952317 TTTAAAATGGTTGTTTTAAATGG - Exonic
978461276 4:108956169-108956191 TTTTATTTAGTTTTTTAAAAGGG + Intronic
978466916 4:109017957-109017979 TTTCAAATGATTGTTTTAGATGG - Intronic
978500741 4:109407629-109407651 TTTTAAAAGATTGTTTAGAAAGG + Intergenic
978949580 4:114541799-114541821 TTTAAAATAGGTGTTTACAAAGG + Intergenic
978950697 4:114555368-114555390 TTTTAAATGTTTGCATACAATGG - Intergenic
978983244 4:114978135-114978157 TTTTTAATGGATTTTTAAAGAGG + Intronic
979650206 4:123120411-123120433 TTTTTAATGGTTAATTATAACGG - Intronic
979786004 4:124716137-124716159 TTTTAAAAGGGTATTTAAGAGGG - Intergenic
979941460 4:126768796-126768818 TTATAACTGATTGTTGAAAATGG - Intergenic
980471619 4:133260250-133260272 AAATAACTGGTTGTTTAAAAAGG - Intergenic
980543417 4:134225632-134225654 TTTTTAATGGCTGTTGTAAATGG - Intergenic
980572324 4:134636950-134636972 TTTTAAGTGGTTATTGGAAAGGG - Intergenic
980646402 4:135647661-135647683 TAGAAAATGGGTGTTTAAAACGG - Intergenic
981262732 4:142741351-142741373 TAATATTTGGTTGTTTAAAAGGG - Intronic
981320457 4:143385966-143385988 TTTTAAATTTTTGTATAAACAGG - Intronic
981424963 4:144592689-144592711 AATTCAGTGGTTGTTTAAAAAGG - Intergenic
981874493 4:149524437-149524459 TTTTAAATGTTTCTTTAATGAGG - Intergenic
981961934 4:150551749-150551771 TTTTCATTAGTGGTTTAAAATGG - Intronic
982168553 4:152638885-152638907 AGTTAAATGATTGTTTTAAAAGG - Intronic
982263017 4:153511912-153511934 TATTAAATGTTTATTTTAAATGG - Intronic
982419994 4:155183581-155183603 TTTTTAATGATTTTTTTAAAAGG + Intergenic
982757803 4:159244279-159244301 TTTTAAAAGGTTGGTCAAAAAGG + Intronic
982824382 4:159984190-159984212 TTTGAAATGGTTCTAAAAAAAGG + Intergenic
983082037 4:163398257-163398279 TTTTAAATGTTTTGATAAAAAGG + Intergenic
983129161 4:163993775-163993797 TATTAAATCCTTTTTTAAAAAGG + Intronic
983448840 4:167886422-167886444 TTCAACATGATTGTTTAAAAAGG + Intergenic
983518933 4:168686728-168686750 TTTTAATTGTTTGTTTGATATGG + Intronic
983570767 4:169206004-169206026 TTTTAACTGATAGTTTTAAATGG + Intronic
983775998 4:171608643-171608665 ATTAATATGGTAGTTTAAAATGG + Intergenic
983867069 4:172780343-172780365 CTTTAAATTGTTGGTTAAATTGG + Intronic
984179933 4:176470130-176470152 TTTTAAATAATTATTTGAAAAGG - Intergenic
984670895 4:182486226-182486248 TTTTAAAAGTTTATTTAAAAGGG - Intronic
984925352 4:184801617-184801639 TTTTAACTTCTTTTTTAAAAAGG + Intronic
985945387 5:3178158-3178180 TTCAAAATTGTTATTTAAAAAGG + Intergenic
986081929 5:4403655-4403677 TTTTAAAGAGTTGTTTCTAAAGG + Intergenic
986460709 5:7968287-7968309 TTTTCTATGGTTGATTAAACTGG + Intergenic
987016112 5:13821263-13821285 TTTTAAATGTTTAATTTAAAAGG + Intronic
987117670 5:14738731-14738753 TTTTAACTGTTTGTATAGAAGGG - Intronic
987737228 5:21862026-21862048 TTTTATGTGGTTATTTTAAATGG + Intronic
987982827 5:25109726-25109748 TTTTAAATGGTTTATTTAAATGG + Intergenic
988160400 5:27512564-27512586 TGTTAAATTGTTTTTTAAACAGG + Intergenic
988371956 5:30381708-30381730 TTTTAAATAGTTGAACAAAACGG + Intergenic
989019590 5:36987019-36987041 TTTTAAATACTTGTGTACAAAGG - Intronic
989086339 5:37680001-37680023 TTTTACATTGTTGGTGAAAATGG - Intronic
989272272 5:39547345-39547367 ATGGAAATGGTTGTCTAAAATGG - Intergenic
989445245 5:41520559-41520581 TTTTCAATGCTTGTTAAAGAAGG - Intergenic
990220762 5:53585964-53585986 TTTAAAATTGTATTTTAAAATGG + Intronic
990307368 5:54506357-54506379 TTTAAAAAGATTTTTTAAAAAGG + Intergenic
990566947 5:57039755-57039777 TTTTAAAGGGTGCATTAAAAAGG + Intergenic
991236135 5:64399720-64399742 ATTTAGATGATTTTTTAAAATGG + Intergenic
991321430 5:65377513-65377535 TCTTAAATGGGATTTTAAAAGGG - Intronic
991704976 5:69349158-69349180 TTTTTAATGTTTGCATAAAATGG - Intergenic
991726843 5:69544034-69544056 TTTTAAATAGTTGATTGGAATGG + Intronic
991868114 5:71083840-71083862 TTTTAAATAGTTGATTGGAATGG - Intergenic
992000807 5:72434493-72434515 TTTTTAATTTTTGTTGAAAATGG - Intergenic
992076945 5:73200838-73200860 TTTCAATTGTTTTTTTAAAATGG + Intergenic
992164298 5:74033687-74033709 TTTTAAATCTTTGTTTAATCTGG - Intergenic
992372438 5:76157521-76157543 TTTTAAATCAGTTTTTAAAAAGG - Intronic
992519884 5:77539701-77539723 CTTCAAATGGTTGCTTTAAAAGG + Intronic
992785683 5:80168509-80168531 TCTAAAATAGTGGTTTAAAAAGG - Intronic
993040183 5:82805515-82805537 TTTAAAAAGCTTTTTTAAAATGG - Intergenic
993484730 5:88468932-88468954 TTTTAATTTGAGGTTTAAAATGG + Intergenic
994109826 5:95988827-95988849 TTTTAAAAAATTGTTTAGAAAGG + Intergenic
994139849 5:96330207-96330229 TTGTAAATGGTCTTTTTAAATGG - Intergenic
994286258 5:97972059-97972081 TTTTAAAAAGAAGTTTAAAAAGG - Intergenic
994402811 5:99303343-99303365 TTTTAAATAGATATGTAAAAAGG - Intergenic
994479771 5:100319661-100319683 TTTTAAATGGTACTTTATATTGG + Intergenic
994570956 5:101513198-101513220 TCTTACATGGTTGTATATAAGGG + Intergenic
994674740 5:102806047-102806069 TGTTAGATGTTTTTTTAAAAAGG - Intronic
994782527 5:104110518-104110540 TTTTAATTTTTTGTTGAAAATGG + Intergenic
994965623 5:106667184-106667206 TTAAAAATGTTTATTTAAAAAGG + Intergenic
995001059 5:107130526-107130548 TTTTAATTGATTGCTTAATAGGG + Intergenic
995084742 5:108095090-108095112 TTTTAAATGAATGTTGTAAATGG - Intronic
995111108 5:108429240-108429262 TTTAAAATGGTTGGGAAAAAGGG - Intergenic
995554968 5:113318447-113318469 TTCAAAATGTTTATTTAAAATGG + Intronic
995558905 5:113359615-113359637 TTTTAATTGTTTTTTTTAAAAGG - Intronic
995681340 5:114723683-114723705 AATTAACTGGTTGTTTAAAGAGG + Intergenic
995767475 5:115634665-115634687 TTTTAAATCCTCATTTAAAATGG + Intergenic
995818502 5:116199891-116199913 TTTTAAAGGGTGATTTCAAAGGG + Intronic
995823239 5:116262885-116262907 TTTTATACTGTTTTTTAAAAAGG - Intronic
995927169 5:117387628-117387650 TTTTAAATGCTTTTTAAAAGTGG + Intergenic
996328609 5:122305447-122305469 TTTGATTAGGTTGTTTAAAAAGG - Intergenic
996454404 5:123663304-123663326 TTTTAAATGTTTATTTAGATAGG + Intergenic
996461913 5:123754666-123754688 TGTTAAATTGATGTTTAAATTGG + Intergenic
997092076 5:130869890-130869912 TTTCAAATCTTTGTTTAGAAAGG - Intergenic
997302563 5:132816368-132816390 TTTCAAATGGTTTTTTAAAATGG - Exonic
997314091 5:132917549-132917571 TTTATAATGTTTGTTTCAAATGG - Intronic
998308067 5:141098517-141098539 TTTTCAATGCTTTTTTATAAAGG + Intergenic
998438899 5:142139317-142139339 TTTTTAATTGTTTTTTTAAACGG + Intronic
998438900 5:142139318-142139340 TTTTAATTGTTTTTTTAAACGGG + Intronic
998641019 5:144011276-144011298 TTTTAGATGGTTATTAAAAATGG - Intergenic
998641024 5:144011320-144011342 TTTTAGATAGTTATTAAAAATGG - Intergenic
998665581 5:144293448-144293470 ATTTAAATTATTGTTTATAAAGG + Intronic
998923137 5:147093059-147093081 TTAAAAATGGATATTTAAAATGG + Intergenic
999220951 5:149977120-149977142 ATTTAGCAGGTTGTTTAAAAAGG + Intronic
999689272 5:154132729-154132751 TTTTAAAATTTTCTTTAAAACGG - Intronic
999771265 5:154777616-154777638 TTTTTAAAGATTTTTTAAAATGG + Intronic
999813415 5:155150840-155150862 TTTTAAATAAGTCTTTAAAAAGG - Intergenic
1000054858 5:157596436-157596458 GTTGAAATTATTGTTTAAAATGG + Intergenic
1000124354 5:158228809-158228831 TTTTACATTGTTTTTTAACAAGG + Intergenic
1000592734 5:163178011-163178033 TTTTAAATTTTTATTTAATAAGG - Intergenic
1000644654 5:163746383-163746405 TTTTAAATGGCTATTGTAAACGG + Intergenic
1000650750 5:163815473-163815495 TGAAAAATGTTTGTTTAAAAAGG + Intergenic
1000714205 5:164621136-164621158 TTTTAAATGGTTGGTTAAATTGG + Intergenic
1000767876 5:165314762-165314784 TATTAAATTATTTTTTAAAAAGG - Intergenic
1001077629 5:168642414-168642436 TTTTAAATGCTTGGAAAAAAGGG - Intergenic
1001726460 5:173906323-173906345 TTTAAATTAGTTGTTAAAAATGG + Intronic
1001767674 5:174264941-174264963 TTTTAAATGCTATTTTAAATGGG - Intergenic
1001826044 5:174745887-174745909 TTTTAAATGCTTGTTGGAAACGG - Intergenic
1002318156 5:178358853-178358875 TATTAAATGCCTGTTTATAAAGG + Intronic
1002763662 6:220664-220686 TTTTAAAATATAGTTTAAAACGG + Intergenic
1002809212 6:610249-610271 TTTTAAACAGCTTTTTAAAATGG + Intronic
1002855786 6:1037104-1037126 TTTTAAAAGTCTTTTTAAAAAGG + Intergenic
1002882119 6:1262368-1262390 TTTTAAAAGGTTAAATAAAAAGG - Intergenic
1002957575 6:1882289-1882311 ATTTAATTGGCTTTTTAAAATGG + Intronic
1002962682 6:1930940-1930962 TTTGAAATGATTGGTTGAAAGGG + Intronic
1003904949 6:10690703-10690725 TTTTAAATTATTGATTGAAAAGG - Intronic
1004088724 6:12477459-12477481 TTTTAAAGTGTTGATTCAAATGG + Intergenic
1004633445 6:17443977-17443999 TTTAAAAGGGTTTTCTAAAAGGG - Intronic
1004633447 6:17443990-17444012 TTTAAAATATTTTTTTAAAAGGG - Intronic
1004808342 6:19229003-19229025 TTTTGAGTTGTTGGTTAAAAGGG + Intergenic
1004970072 6:20899836-20899858 TTTTAAATGTTTTTTTGAGACGG - Intronic
1005176450 6:23050775-23050797 TTTGAATGGGTTGTTTCAAATGG + Intergenic
1005433025 6:25778460-25778482 CAGGAAATGGTTGTTTAAAATGG + Intronic
1005942144 6:30568588-30568610 TTTTAAATTGTTAAATAAAAAGG - Intergenic
1006699970 6:35964241-35964263 TTATACATGGTTGTTGAAATAGG + Intronic
1006821309 6:36898054-36898076 AATTAAATGGCTATTTAAAAAGG - Intronic
1008340960 6:50363485-50363507 TTTTAAATGAATGATTAAAAGGG + Intergenic
1008383761 6:50863353-50863375 TTTTAAAGGGATGTGTATAAGGG + Intergenic
1008665919 6:53716369-53716391 TTTTAAAACTTTTTTTAAAAAGG + Intergenic
1008786236 6:55172258-55172280 TTAGAAATGATTGTTCAAAAAGG - Intronic
1008821481 6:55637015-55637037 TTTTAGCTGGCTCTTTAAAAAGG - Intergenic
1008831882 6:55774558-55774580 TTTTAAATTGTTATTTAATGTGG - Intronic
1008839767 6:55888256-55888278 TTTTAAAACTATGTTTAAAATGG + Intergenic
1008849169 6:56003615-56003637 TTTTAAAATTTTTTTTAAAAAGG - Intergenic
1008875962 6:56328063-56328085 TTTTAAATGTTTGTTTTAAGGGG + Intronic
1009378307 6:62998973-62998995 TTTTAAATATTTTTTTTAAATGG + Intergenic
1009403671 6:63287253-63287275 GTTTAATTGTTTGTTTTAAATGG - Intronic
1009922827 6:70084066-70084088 GTTTAAATCTTTGTGTAAAAGGG - Intronic
1010032479 6:71286016-71286038 TTTCAAAAGGTGGTGTAAAAGGG + Intergenic
1010517747 6:76793689-76793711 TTTTAAATGGTTTTTGGACATGG + Intergenic
1010533934 6:77002330-77002352 TTTTAAATTATTATTTTAAATGG + Intergenic
1010565519 6:77407367-77407389 ATTTAAATGGATGTTCAAAATGG - Intergenic
1010757275 6:79680964-79680986 TTTTAACTGGTGGTTGGAAATGG + Intronic
1010788871 6:80040188-80040210 TTTAATAGTGTTGTTTAAAAAGG + Exonic
1010819052 6:80391916-80391938 TTTGAAATGGTTTTTTAAAAAGG - Intergenic
1011051743 6:83158529-83158551 TGTTAAATGTTTATTTAAACTGG - Intronic
1011355745 6:86471801-86471823 TTTTAAATTGTTGGTAAAATAGG + Intergenic
1011383731 6:86770911-86770933 GTTAAAATGGTTATTTAATAGGG + Intergenic
1011456598 6:87557005-87557027 TATTAAAGAGTTGGTTAAAATGG + Intronic
1012071009 6:94616317-94616339 TCTTAAATGTGTGTTGAAAAGGG + Intergenic
1012150083 6:95738651-95738673 TTTTACATTAATGTTTAAAAGGG - Intergenic
1012300135 6:97577175-97577197 TTATAAATGATTTTCTAAAAAGG - Intergenic
1012497388 6:99848990-99849012 TTTCAAATTGTTTTTCAAAAGGG + Intergenic
1012634574 6:101520973-101520995 TTTTAAATGTTTTTTTAACCTGG - Intronic
1012913149 6:105138976-105138998 TTTTTAATGGCTGTTTAAACTGG - Intergenic
1012964559 6:105658983-105659005 TGTAAAATGGTATTTTAAAAAGG - Intergenic
1013275523 6:108581211-108581233 TTGTATATGGTGGTTTAAGAAGG + Intronic
1013602475 6:111718071-111718093 TTTTAAATTGTTTTTAAAGAAGG - Intronic
1014133101 6:117857208-117857230 AAATAACTGGTTGTTTAAAAAGG - Intergenic
1014237884 6:118980508-118980530 TTTTAAATGGTGATATTAAATGG - Intronic
1014246079 6:119070576-119070598 TTATAAATGGTAGTTTGATATGG - Intronic
1014302742 6:119703559-119703581 GGTTAAATGATTATTTAAAAGGG + Intergenic
1014332315 6:120085303-120085325 TTTTAAATGTTTGTTTTACTTGG - Intergenic
1014341961 6:120221205-120221227 TTTAGAATTGTTGTTTATAATGG - Intergenic
1014444874 6:121515397-121515419 TTTTAAAGGTTTGCTTTAAAAGG + Intergenic
1014923716 6:127244874-127244896 TTTAAAAAAGTTTTTTAAAATGG - Intergenic
1014931756 6:127344192-127344214 TTTTAAAGGGACGTTTTAAAAGG + Intergenic
1014983228 6:127970976-127970998 GCATAAATGGCTGTTTAAAATGG - Intronic
1015186535 6:130422799-130422821 TTTTAAATAGTTGGTTGAAAGGG - Intronic
1015547886 6:134380318-134380340 TTTTAAATGTTTATTTGAATGGG + Intergenic
1015605279 6:134948520-134948542 TTTTAATTTTTTGTTAAAAAAGG + Intronic
1016146715 6:140686666-140686688 TTTCCAATGCTAGTTTAAAAAGG - Intergenic
1016212543 6:141556315-141556337 TTTAAAATGGTAGGTTTAAATGG + Intergenic
1016303457 6:142657265-142657287 TTCTAAATGGGTATTTAACAAGG + Intergenic
1016348485 6:143141715-143141737 TTTGTAATGCTTCTTTAAAAGGG - Intronic
1016426424 6:143940840-143940862 TTTAAAATGCTTCTGTAAAATGG + Exonic
1016537427 6:145124613-145124635 TTTTACTTGGCTGTTAAAAAAGG + Intergenic
1016899706 6:149089348-149089370 TTTTAAATGTTTTTTTGAGACGG - Intergenic
1017220868 6:151963835-151963857 TTTTGAATGGATTTTTAATAGGG + Intronic
1017320830 6:153090988-153091010 TTTTAAATTGTTTTGTTAAATGG - Intronic
1017565572 6:155681713-155681735 TTTAAAATGATTTTTTAAAATGG - Intergenic
1017572204 6:155758118-155758140 TTTTAAGTGGTATTTAAAAATGG + Intergenic
1017694460 6:157000668-157000690 TTAGAAATGGGTGTTTAGAAAGG - Intronic
1017960957 6:159220019-159220041 TTTTAAAATGTTTTATAAAAGGG - Intronic
1018044060 6:159950754-159950776 TTTTAAAAGAGTTTTTAAAAAGG + Intergenic
1018510966 6:164524506-164524528 TTATAAATGTTTCTATAAAAAGG + Intergenic
1018513962 6:164557686-164557708 TTTTACATGGATGTTTACAGTGG - Intergenic
1018642324 6:165916137-165916159 TTTTAAAAGAATATTTAAAATGG - Intronic
1018989374 6:168661903-168661925 TTTTAAATAGTTGGTTTCAATGG - Intronic
1019978956 7:4606832-4606854 TCATAAATGGTTGTTTAATGAGG + Intergenic
1020399460 7:7759049-7759071 TCTTACATGGTTATTTAAACTGG + Intronic
1020529174 7:9307905-9307927 TTTTAGTTTATTGTTTAAAATGG - Intergenic
1020764682 7:12304969-12304991 TTTTACATAGTTATTAAAAATGG + Intergenic
1020888313 7:13847299-13847321 TTCCATATGGTTGTTTCAAAGGG + Intergenic
1021236509 7:18149005-18149027 TTTTAAATTGCTATTTTAAATGG + Intronic
1021596352 7:22321142-22321164 TTTTCCATGGTTCATTAAAATGG - Intronic
1021694106 7:23259534-23259556 TATTAAGTGGATTTTTAAAAGGG - Intronic
1021807579 7:24372607-24372629 TTTTAAATCTTAGTTTTAAAAGG + Intergenic
1021827253 7:24567558-24567580 TTTTAAATGAGTATCTAAAAGGG + Intergenic
1022732405 7:33042015-33042037 TTTTAAATTGCTGTTAAAAATGG + Intronic
1022751902 7:33237673-33237695 ATTTAAATGGTTGTTGAAGAAGG - Intronic
1023045440 7:36206292-36206314 TTTTAAATTTTCTTTTAAAAAGG + Intronic
1023178037 7:37452659-37452681 CTTTAAATGTGAGTTTAAAAGGG + Intergenic
1023238466 7:38115942-38115964 TTTTAAATGGATGCTTTAAAAGG + Intergenic
1023584290 7:41712972-41712994 TTTTAAATTATTATTTAAAATGG + Intergenic
1023896992 7:44442319-44442341 TGTTATTTGGTTGTTTTAAAAGG + Intronic
1024424107 7:49205944-49205966 TTTTAAATCCATTTTTAAAAAGG - Intergenic
1024591094 7:50884342-50884364 TTTAAAATGGATTTTTAAAATGG - Intergenic
1024774432 7:52765996-52766018 GGGTAAATGGTTGTGTAAAATGG - Intergenic
1024810841 7:53210033-53210055 TTTTATATGATAGTTTTAAATGG - Intergenic
1024869832 7:53951278-53951300 TTGTAAATCATTGATTAAAATGG - Intergenic
1025820553 7:64959023-64959045 TTTTAAAGACTTGTTTCAAAGGG + Intergenic
1026290828 7:69004177-69004199 TTTTAAACTGTTGGATAAAATGG - Intergenic
1026443265 7:70461942-70461964 TTTTAAATAGCTTTTTAAAGCGG + Intronic
1026599222 7:71761698-71761720 TTTAAAATAATTGTTTTAAAGGG - Intergenic
1027240667 7:76325992-76326014 TTTTGTTTTGTTGTTTAAAACGG + Intergenic
1027683878 7:81256824-81256846 TTTTAAGAGGTTTTTTTAAAGGG + Intergenic
1027927856 7:84490141-84490163 TTTTAAATGGTTCTTTTTACTGG - Intronic
1027932736 7:84559904-84559926 TTTTAAATGCTTTTTTAGATGGG - Intergenic
1028089027 7:86674068-86674090 TAATAAATGCTTGTTTTAAATGG - Intronic
1028541842 7:91951036-91951058 TTACTAATGGTTGTTTAAAGTGG - Intronic
1028621087 7:92830456-92830478 TCTTTAATGGTTTCTTAAAAGGG - Intronic
1028638074 7:93013483-93013505 TTTAAAATGTTTTCTTAAAAAGG + Intergenic
1028667209 7:93360385-93360407 TTTTTAATGCTTTTTGAAAAAGG + Intronic
1028863047 7:95676488-95676510 TTTCAAATGGGTGTTGGAAAAGG - Intergenic
1030332811 7:108290460-108290482 TTTTAAATGTTTGAGGAAAATGG - Intronic
1030490946 7:110233694-110233716 ATTTTAATGATTCTTTAAAAAGG - Intergenic
1030814260 7:114015556-114015578 TTTTGTATGCATGTTTAAAAGGG - Intronic
1030850072 7:114472657-114472679 TTTAAAATGGGAGTTTGAAATGG + Intronic
1030880637 7:114874098-114874120 TTTTAAATGGGCATTTAAAAAGG - Intergenic
1030957310 7:115870490-115870512 TTTTAAATTATTGTTTAGTAAGG - Intergenic
1031223780 7:119008107-119008129 TTTTGAATGATTATTTAAAATGG - Intergenic
1031285780 7:119866245-119866267 TTTTAAAATGTTGTTTAAATTGG + Intergenic
1031313034 7:120223059-120223081 TTTTTATTGGTTGTTTAAACTGG + Intergenic
1031515860 7:122697981-122698003 ATTCAAGTGGTTGTTGAAAATGG - Exonic
1031520104 7:122753899-122753921 TTTTGAATGGTTGTTTAAAAGGG - Intronic
1031868930 7:127071301-127071323 CTTTAAAAGGTTTTTTCAAATGG + Intronic
1032233320 7:130096387-130096409 TATTAAATGTTTGTTTAATTTGG + Intronic
1032398789 7:131609491-131609513 TTTTAAATTGTTGGTACAAATGG + Intergenic
1032412337 7:131705261-131705283 TTTTAATTTCTTTTTTAAAAGGG + Intergenic
1032628512 7:133620946-133620968 TTTTAAATGGTTGATCAACAAGG - Intronic
1033521872 7:142168718-142168740 TTTTAAATGTATATTTTAAAAGG + Intronic
1033543362 7:142377294-142377316 AATTAAATGGCTGTCTAAAATGG - Intergenic
1033779615 7:144653042-144653064 TTTTAAATGGTTGCTTTATTTGG - Intronic
1033972229 7:147056227-147056249 TGATAAATGGTTGGTTAAGAAGG - Intronic
1034220310 7:149439376-149439398 TTTTATATGTTTATTCAAAAAGG - Intronic
1034421254 7:150992272-150992294 TTTCAAATGGTGGCTTAATATGG + Intronic
1034614050 7:152399338-152399360 TTTTAAACTACTGTTTAAAATGG - Intronic
1035116715 7:156530952-156530974 TTTTAAATAGTAATTTAAAATGG + Intergenic
1035465106 7:159069814-159069836 ATTTAAAATGTTTTTTAAAAGGG - Intronic
1036101189 8:5787084-5787106 TTTTTATTGGTTGTTAGAAATGG + Intergenic
1036164496 8:6419917-6419939 TTTAAAATAGATTTTTAAAATGG + Intronic
1036700329 8:11008988-11009010 TTTTAGATTGTTGTCTAAAGTGG + Intronic
1037031473 8:14111550-14111572 TTTTAAGGGGCTGTTCAAAAGGG + Intronic
1037202080 8:16267419-16267441 TTTTAAGTGACTTTTTAAAAAGG + Intronic
1037589356 8:20300272-20300294 TAGTAAATGCTTGTTTAATAAGG - Intronic
1037764153 8:21761637-21761659 CAATAAATGCTTGTTTAAAAAGG + Intronic
1038014467 8:23502325-23502347 TTTTATTTGATTTTTTAAAATGG + Intergenic
1038134631 8:24771975-24771997 ATTTAAATGGTTCACTAAAATGG + Intergenic
1038767583 8:30443260-30443282 TTTTAAATAGTTTTTTAAAATGG + Intronic
1038921463 8:32089482-32089504 TTTTAAGTGCTTATTTCAAACGG + Intronic
1038968788 8:32607823-32607845 TTTTTGTTGGTTGTTTAAGAAGG - Intronic
1039323599 8:36460816-36460838 TTTTAAACAATTGTTTAAAATGG + Intergenic
1039520740 8:38168909-38168931 TCTCAAATGGCTGTTAAAAATGG + Intronic
1040740383 8:50567694-50567716 TTTTAAATTAATGTTTTAAATGG + Intronic
1040771729 8:50986160-50986182 TTTCAAAGGTTTATTTAAAATGG - Intergenic
1040991109 8:53350959-53350981 AAATAACTGGTTGTTTAAAATGG - Intergenic
1041061353 8:54037734-54037756 TTTTAAATTGTTTTTTATAGAGG - Intergenic
1041212568 8:55567687-55567709 TATTAAATGGTTTTTTGCAAAGG + Intergenic
1041464212 8:58142693-58142715 TTTCAAATGGATGTTAAACAGGG + Intronic
1041892993 8:62892130-62892152 AATTAAATGGTTGTATAAAAAGG - Intronic
1041995806 8:64056398-64056420 TAATAAATTGTTGCTTAAAAAGG - Intergenic
1042840802 8:73121541-73121563 TTTTAAAATGTGGCTTAAAATGG - Intronic
1043144127 8:76630445-76630467 TTTTTAATGGCTGAGTAAAATGG - Intergenic
1043188613 8:77188009-77188031 TTTTAAATTGTTTTTTCACATGG + Intergenic
1043377964 8:79671187-79671209 TGTGAACTGGTTGTTTAAAAGGG - Intergenic
1043866087 8:85377502-85377524 TTTTAAATGGTAATTTATATTGG + Intronic
1043888005 8:85624547-85624569 TTTTAAATGGGGTTATAAAATGG + Intergenic
1044023195 8:87133162-87133184 TTTTAAATAGTTTTTGACAATGG + Intronic
1044408048 8:91852983-91853005 TTTCAAATTGTTCTCTAAAATGG - Intergenic
1044681566 8:94783931-94783953 ATTAAAAAGGTTTTTTAAAATGG - Intronic
1044711898 8:95066541-95066563 TTTTAAATCATTGTCTAAAGTGG + Intronic
1044795748 8:95895648-95895670 TTTTAAAGAGTTAGTTAAAATGG - Intergenic
1044919048 8:97148571-97148593 TATTCTATGTTTGTTTAAAACGG - Intronic
1045010976 8:97958085-97958107 TTTGAAATGGTACTTTCAAAAGG + Intronic
1045239018 8:100382087-100382109 TTTAAAAAAGTTATTTAAAAAGG - Intronic
1045354648 8:101374849-101374871 TTTTAAATGTTTGTAAAAAGTGG - Intergenic
1045450080 8:102315042-102315064 TTTCAAATAGTGGTTTAATATGG + Intronic
1045478496 8:102574222-102574244 TTGAAAATGTTTGTTTAAGATGG + Intergenic
1045588489 8:103565620-103565642 TTTTATATAATTGTATAAAAAGG + Intronic
1045605153 8:103765223-103765245 TTTTAAATGATTAATTGAAAAGG + Intronic
1045616881 8:103925324-103925346 TTTTAAATGGGCATATAAAATGG - Intronic
1045709591 8:104967503-104967525 TAATAAATGGTTGTTGAAAGGGG - Intronic
1045800832 8:106098352-106098374 ATTGAAATAGTTTTTTAAAATGG + Intergenic
1046061125 8:109140837-109140859 TTTTAAATGCCATTTTAAAAAGG + Intergenic
1046266724 8:111839690-111839712 TTTTTAATAGTTATTTTAAATGG - Intergenic
1047810874 8:128407664-128407686 TATTACATGGTTGAATAAAAAGG + Intergenic
1047890867 8:129307217-129307239 AGTTAAATGGTTATTTAATAGGG + Intergenic
1048081320 8:131130840-131130862 TTTTAACTCATTGTTTAAATAGG + Intergenic
1048156479 8:131960042-131960064 ATTTAAATGGTTGTATACATAGG - Intronic
1048157995 8:131980303-131980325 TTTTAAATGAAGTTTTAAAATGG - Intronic
1048159841 8:132006285-132006307 TTTGAAATGGTTGATAAAATTGG + Intronic
1048305655 8:133282495-133282517 TTTCACAGGGTTTTTTAAAAGGG + Intronic
1048724444 8:137366564-137366586 TTTTAAATTGTAGTTTCAAAGGG + Intergenic
1048788732 8:138080320-138080342 TTTTAATTGGCTCTTTTAAAGGG - Intergenic
1048797633 8:138165986-138166008 ATTTAAATGATGCTTTAAAATGG - Intronic
1050465084 9:5913759-5913781 TGTTAAATGTTTCCTTAAAAAGG + Intronic
1051235928 9:14999054-14999076 TTTTACATGATTTTTTAATAGGG - Intergenic
1051279206 9:15424352-15424374 TTTTGAATGTTTGTTTATAGAGG + Intronic
1051931978 9:22396555-22396577 TCTTAAATATTTGTTTTAAAGGG - Intergenic
1051972609 9:22909138-22909160 TTTTAAATGATTTTTGAACAAGG - Intergenic
1052031292 9:23631925-23631947 TTTTCAAAGGTTGTTAAAAATGG + Intergenic
1052189307 9:25639384-25639406 TTTCAAATGCTTGTTGAAAAGGG + Intergenic
1052503299 9:29320480-29320502 CTTTAAAGGATTATTTAAAATGG + Intergenic
1052572057 9:30239276-30239298 TTCAAAATGGTATTTTAAAATGG - Intergenic
1052680021 9:31679252-31679274 TTTTGTATGGTTCTTTAGAATGG - Intergenic
1052931865 9:34062361-34062383 TTTGAAAATGTTGTTTATAAAGG - Intergenic
1053689122 9:40573138-40573160 TTTTAAATTGGTGTTAAGAAAGG - Intergenic
1054274911 9:63057928-63057950 TTTTAAATTGGTGTTAAGAAAGG + Intergenic
1054300366 9:63374070-63374092 TTTTAAATTGGTGTTAAGAAAGG - Intergenic
1054399914 9:64707001-64707023 TTTTAAATTGGTGTTAAGAAAGG - Intergenic
1054433502 9:65191262-65191284 TTTTAAATTGGTGTTAAGAAAGG - Intergenic
1054496883 9:65830407-65830429 TTTTAAATTGGTGTTAAGAAAGG + Intergenic
1055008758 9:71539533-71539555 TTGTAAAGGTTGGTTTAAAATGG + Intergenic
1055207895 9:73754620-73754642 TTTTACATCGTTAGTTAAAATGG - Intergenic
1055267186 9:74508458-74508480 TTTTGAAAGGTTGTCTAACATGG + Intronic
1055303841 9:74908627-74908649 CTTTAAATGGTTGTTATGAATGG + Intergenic
1055709742 9:79047792-79047814 TTTTGAATGGTGGTTACAAAGGG - Intergenic
1055858612 9:80722678-80722700 TTTAAAAACGTTTTTTAAAAAGG - Intergenic
1056738697 9:89234070-89234092 TTTTAAATGATTGTTGAATATGG + Intergenic
1057492354 9:95530763-95530785 TTTAAAATTGTTGTTTAGACAGG - Intergenic
1057613536 9:96567614-96567636 TTTTAAATGGTTGTTTAAAAAGG - Intronic
1057737241 9:97674827-97674849 TTTTAAATGCTGGATTAAAATGG - Intergenic
1058217356 9:102251684-102251706 TTTAACATGATTGTTGAAAATGG - Intergenic
1058536709 9:105968200-105968222 GTTTGAATGGTTTTTTAGAAGGG + Intergenic
1058654733 9:107209793-107209815 TTTTAAATATTTCTTTAAAAAGG - Intergenic
1058738095 9:107915103-107915125 TTTTAAATGGTGTCTTATAAAGG - Intergenic
1058827273 9:108786356-108786378 TGTTTAATGGTTCTATAAAAGGG - Intergenic
1059200690 9:112413008-112413030 TTTTAAGTGGCTGTTTATAAAGG - Intronic
1059229676 9:112707295-112707317 TTTTTATTTGTTTTTTAAAAAGG - Intronic
1059299453 9:113300455-113300477 ATTTTAATGGTTGTTAATAAAGG + Intronic
1059519963 9:114931889-114931911 TTTTAAACGGTATTTTGAAATGG - Intergenic
1059835504 9:118147673-118147695 TTCTAAATTGTTGTTTTTAAAGG - Intergenic
1060131996 9:121110706-121110728 TTTTTAATGGATGTTTATATAGG + Intronic
1060606952 9:124923606-124923628 TTTTAAATAATTGTGAAAAAGGG + Intronic
1060631246 9:125160800-125160822 TATCAAGTGCTTGTTTAAAATGG - Intronic
1061220375 9:129247050-129247072 TTTTAAATTTTTTTTTGAAAAGG - Intergenic
1061330286 9:129888282-129888304 TGTGAAACGGTTCTTTAAAATGG - Exonic
1062645172 9:137544140-137544162 TTTTAAAGGGTTGTAGCAAAGGG - Intronic
1185887139 X:3792939-3792961 TGTTAGATGGTTTTTTAAAAAGG + Intergenic
1186121942 X:6372882-6372904 TTTTAAAAGCTTGTTTCACAAGG - Intergenic
1186501463 X:10054264-10054286 TTTTAAATGATTATTCCAAATGG + Intronic
1187010791 X:15276998-15277020 TTTTAAAAGGTTGTCCCAAAGGG + Intergenic
1187226420 X:17377794-17377816 TAATGACTGGTTGTTTAAAAGGG + Intronic
1187517936 X:19989918-19989940 TTTTTAATGTTTTTTTTAAATGG - Intergenic
1187744001 X:22388334-22388356 TTTTAAATGGATATATAAAAGGG + Intergenic
1188154014 X:26718416-26718438 TTTTCAAAGGTTCTTTAATATGG + Intergenic
1188250334 X:27885544-27885566 TTTTTAAATGTTCTTTAAAACGG - Intergenic
1188314052 X:28652074-28652096 TTTAAAATGGTTTATTAATAGGG + Intronic
1188429890 X:30094644-30094666 TTGTAACTGGCTGTATAAAATGG - Intergenic
1188453951 X:30340188-30340210 TATCAAATGGTTGGTGAAAAGGG + Intergenic
1188514598 X:30971794-30971816 TTTAAAATGGTTAGCTAAAATGG + Intronic
1188628751 X:32323643-32323665 CATAAAATTGTTGTTTAAAATGG + Intronic
1188666715 X:32831930-32831952 TTGTCACTGGTTGTCTAAAAAGG - Intronic
1188828981 X:34872957-34872979 TTTTAAACGTCTATTTAAAATGG + Intergenic
1188936934 X:36187644-36187666 TAATAAATGTTTTTTTAAAAAGG + Intergenic
1189682490 X:43531106-43531128 TGTTAAATGAATGTTTAAAGGGG + Intergenic
1190446354 X:50528637-50528659 TTTAAAATGGTTGTGAAAGAGGG - Intergenic
1190451779 X:50589313-50589335 TTTTAAATGGGTGTGCTAAATGG - Intergenic
1190867847 X:54399656-54399678 TTTTAAATGGGTGTTTAGGCCGG - Intergenic
1192059499 X:67808891-67808913 TTTTAACTGACTTTTTAAAAAGG - Intergenic
1192824874 X:74684380-74684402 TTTTTATTGTTTTTTTAAAAAGG - Intergenic
1193424884 X:81329655-81329677 TTTCAAACTGTTCTTTAAAAAGG - Intergenic
1193501465 X:82280382-82280404 AAATAAATGGTTGTTTAAGAAGG + Intergenic
1193845504 X:86465692-86465714 TTTTTAATGCTTTTTCAAAATGG + Intronic
1193883558 X:86957286-86957308 TTTTAGTTGGCTGTTTTAAATGG + Intergenic
1193953568 X:87829597-87829619 TTATATATGGGAGTTTAAAAAGG - Intergenic
1194313856 X:92349302-92349324 TTTTATTCTGTTGTTTAAAATGG - Intronic
1194433736 X:93844092-93844114 TTATAGATGGATGTTTAAGATGG + Intergenic
1195298030 X:103499688-103499710 TTTTAAACGTGTGTTTATAAAGG - Intergenic
1195483192 X:105372122-105372144 TTTTTAATAGTTGGTTAAAAAGG - Intronic
1195594340 X:106671591-106671613 TGTCAAATGGTTCTCTAAAATGG + Intronic
1195785332 X:108513801-108513823 TTTTATATGTTTGTTTATAAAGG + Intronic
1196217192 X:113067211-113067233 TTTTTAATGTTTGTTTAATTTGG + Intergenic
1197172155 X:123446293-123446315 GTTTAAATGAATGTTTAAGATGG - Intronic
1197190856 X:123646661-123646683 TTTTAATTGGCAGGTTAAAAAGG + Intronic
1197325865 X:125092453-125092475 TTTTAAATTGTTGTTTCCATTGG - Intergenic
1197334489 X:125195418-125195440 TTTTAACTGGTAATTTAACATGG - Intergenic
1197358151 X:125462603-125462625 ATTTGAATGGTTGTTCAGAATGG - Intergenic
1197852253 X:130875080-130875102 TTTTAAAAAGTAGTTTTAAAAGG + Intronic
1198543555 X:137667737-137667759 TTTTAGATCGCTGTTTGAAATGG + Intergenic
1198867026 X:141133980-141134002 TTTTCAAGGGCTGTTTAACAGGG + Intergenic
1198869752 X:141164290-141164312 TTTTTAGTGGATGTATAAAATGG + Intergenic
1198891118 X:141397580-141397602 TAAAAAATGGTTGTTCAAAATGG + Intergenic
1199378012 X:147135024-147135046 AAATAACTGGTTGTTTAAAAAGG + Intergenic
1199555935 X:149108786-149108808 TTTTCAAAGGTGGTTTCAAAAGG - Intergenic
1199899061 X:152155239-152155261 TTTTTAAGTGTTCTTTAAAAAGG + Intergenic
1200622125 Y:5463402-5463424 TTTTATTCTGTTGTTTAAAATGG - Intronic
1200775186 Y:7164186-7164208 TACTAGATGGTTTTTTAAAAAGG - Intergenic
1201469690 Y:14319381-14319403 TTTTAAATGGGTGGTTAGGAAGG + Intergenic
1202233980 Y:22688286-22688308 TTTTAAATTGATTTTTGAAAAGG - Intergenic
1202309176 Y:23507872-23507894 TTTTAAATTGATTTTTGAAAAGG + Intergenic
1202561625 Y:26162720-26162742 TTTTAAATTGATTTTTGAAAAGG - Intergenic