ID: 1057613537

View in Genome Browser
Species Human (GRCh38)
Location 9:96567627-96567649
Sequence ATCTCTACAATAATTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 1, 1: 0, 2: 13, 3: 104, 4: 761}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057613537_1057613539 -6 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613539 9:96567644-96567666 AGAGATAGAGAGTAGAAGGATGG 0: 26
1: 280
2: 840
3: 2118
4: 5704
1057613537_1057613545 22 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613545 9:96567672-96567694 GGAGGCTGGGAAAGGTAGTGTGG No data
1057613537_1057613538 -10 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG No data
1057613537_1057613543 9 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613543 9:96567659-96567681 AAGGATGGTTATCGGAGGCTGGG No data
1057613537_1057613548 25 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613548 9:96567675-96567697 GGCTGGGAAAGGTAGTGTGGGGG No data
1057613537_1057613540 1 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613540 9:96567651-96567673 GAGAGTAGAAGGATGGTTATCGG No data
1057613537_1057613541 4 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613541 9:96567654-96567676 AGTAGAAGGATGGTTATCGGAGG No data
1057613537_1057613542 8 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613542 9:96567658-96567680 GAAGGATGGTTATCGGAGGCTGG No data
1057613537_1057613544 14 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613544 9:96567664-96567686 TGGTTATCGGAGGCTGGGAAAGG No data
1057613537_1057613547 24 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613547 9:96567674-96567696 AGGCTGGGAAAGGTAGTGTGGGG No data
1057613537_1057613546 23 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613546 9:96567673-96567695 GAGGCTGGGAAAGGTAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057613537 Original CRISPR ATCTCTACAATAATTTTAAA TGG (reversed) Intronic
900196593 1:1379590-1379612 ATCTCTACAAAAAATTAAGAAGG + Intergenic
901254016 1:7805379-7805401 ATCTCTACTGTAATATTAACAGG - Intronic
901698820 1:11032067-11032089 ATCTCTACCAAAAATTTAAAAGG + Intronic
901840562 1:11951395-11951417 ATCTCTACTAAAAATATAAAAGG + Intronic
902125365 1:14205481-14205503 ATCTTTACAATAAATTAAATTGG - Intergenic
902589497 1:17463436-17463458 ATCTCTTCAAATATTTTACAGGG - Intergenic
902967367 1:20016864-20016886 ATGGCTACAATAATTTCTAAGGG - Intergenic
905160678 1:36030849-36030871 AACACTACAAAAATTTTTAAAGG - Intronic
905508313 1:38498260-38498282 ATCTCTTTAATAATTTTAAGTGG - Intergenic
905643474 1:39608372-39608394 ATTTTTGCAATAATTTTACAAGG - Intergenic
906873047 1:49505186-49505208 ATAGCTACAATACTTTTTAAGGG - Intronic
907733768 1:57092280-57092302 ATATCAACCATAATCTTAAAAGG - Intronic
908067509 1:60423283-60423305 ATTTCTACAAGAAAATTAAAAGG - Intergenic
908169133 1:61487501-61487523 ATCTCCACAACAATCTTGAAAGG + Intergenic
908225778 1:62054522-62054544 TTCTTTAAAATATTTTTAAAGGG + Intronic
908349414 1:63270048-63270070 ATCTTTCCAATAAATTTATAAGG + Intergenic
908403603 1:63793085-63793107 ATGCATAGAATAATTTTAAAGGG - Intronic
909132220 1:71751846-71751868 ATGTCAATAATAATTTTAAATGG - Intronic
909268790 1:73596903-73596925 ATCTTTAGATTATTTTTAAAAGG + Intergenic
909327164 1:74365171-74365193 ATCTTTACAACAATCTTACAAGG + Intronic
909572581 1:77133826-77133848 ATTTCTAATATAATTTTCAAAGG + Intronic
909824264 1:80107077-80107099 ATCTCTACAACAACTTAATAGGG - Intergenic
909985213 1:82153324-82153346 CTCTCTTCAAGAATTTTAACAGG - Intergenic
910077779 1:83300496-83300518 ACCACTACAAGAACTTTAAAAGG + Intergenic
910266748 1:85345983-85346005 AACTCTACTATAATCTCAAATGG + Intronic
910420816 1:87060304-87060326 ATATATCAAATAATTTTAAAAGG + Intronic
910531385 1:88239773-88239795 ATTTCTACTATTCTTTTAAATGG - Intergenic
910662009 1:89683759-89683781 ATATCTACAATGATATAAAAAGG + Intronic
911496355 1:98636742-98636764 ATCTCTAAAATTATTATAAAAGG - Intergenic
911786378 1:101954141-101954163 ATCATTAAAATAATTTTAAATGG - Intronic
912044689 1:105438796-105438818 ATCTCTAAAATTATATTAATAGG + Intergenic
912605923 1:110988463-110988485 ATAGCTGCAATAATTTTTAAGGG + Intergenic
912887184 1:113487377-113487399 GTGTATACAATAATTTTAACTGG + Intronic
912982995 1:114395459-114395481 TTATCTACAATTTTTTTAAAAGG + Exonic
913085120 1:115429770-115429792 TTCTCTGCAATATTTTTATAGGG + Intergenic
913546920 1:119878086-119878108 ATATCAAAAATAATTTTAAAAGG - Intergenic
913596336 1:120381471-120381493 ATCTCCACAATAATATTCCAAGG + Intergenic
914090935 1:144497504-144497526 ATCTCCACAATAATATTCCAAGG - Intergenic
914307665 1:146436705-146436727 ATCTCCACAATAATATTCCAAGG + Intergenic
914594444 1:149136433-149136455 ATCTCCACAATAATATTCCAAGG - Intergenic
914926002 1:151888272-151888294 ATCTCAACATCAATTATAAAAGG - Exonic
914953009 1:152134077-152134099 ATAACTACAATAATTTTTAATGG + Intergenic
916622782 1:166519021-166519043 ATATTGACAATAATTTTAAAGGG + Intergenic
917370465 1:174288163-174288185 ATAGCTAAAATAATTTTAATGGG - Intronic
917895492 1:179483351-179483373 ATTTCTCAAATAATTTTCAATGG + Intronic
917999126 1:180474622-180474644 TTCTCTACAAGACTGTTAAAAGG + Intronic
918104429 1:181404245-181404267 ATCTCTCCAATGATCTAAAAAGG - Intergenic
918213787 1:182375310-182375332 ATCTCTACAAAAATTAAAAATGG - Intergenic
918685054 1:187403963-187403985 AAATCAACAAAAATTTTAAATGG + Intergenic
918822789 1:189278705-189278727 ATTTCTACAATAAAATTGAAAGG + Intergenic
918942504 1:191018899-191018921 TTCCCTACAATCATTTTAATTGG - Intergenic
919122155 1:193354546-193354568 ATCTTTACAATAATAGTAAAAGG - Intergenic
920530241 1:206696532-206696554 ATCTCTACAAAAAATTAAAAAGG + Intronic
921487008 1:215726946-215726968 ATCTCTGCAATATTATAAAACGG + Intronic
921487458 1:215732302-215732324 ATCTCTAAAGAATTTTTAAAAGG - Intronic
921503267 1:215933379-215933401 ATTGAGACAATAATTTTAAAAGG - Intronic
921647687 1:217637200-217637222 ATGTTTACAATAATCTTATAAGG + Intronic
922413052 1:225394180-225394202 ATATCAATAATCATTTTAAAAGG - Intronic
922519102 1:226231310-226231332 AACTATACAAAAATTTCAAATGG + Exonic
922694485 1:227721840-227721862 ATCTCTTCAAATATTTTACAGGG + Intergenic
922943632 1:229491476-229491498 ATCTCTAAAATAAATTTAAAAGG + Intronic
923447496 1:234086089-234086111 ATTTCTTCAATAATTTTATCAGG - Intronic
923889238 1:238193212-238193234 ATCTGTACATTTTTTTTAAAAGG + Intergenic
923955607 1:239015386-239015408 ATCTCTAGAATTTTTTTTAATGG - Intergenic
923984310 1:239363576-239363598 ATCTCATTAATAATTTTATATGG + Intergenic
924027347 1:239848274-239848296 ATTTCCAGAATAATTTTGAATGG - Intronic
924374385 1:243390258-243390280 GTGTCAAAAATAATTTTAAATGG + Intronic
924903036 1:248422029-248422051 ATTTCTAAAATAATATAAAACGG - Intergenic
924924824 1:248669774-248669796 ATTTCTAAAATAATATAAAATGG + Intergenic
1063242158 10:4182154-4182176 ATTTCTATAATAATTTTACTTGG + Intergenic
1063999669 10:11653255-11653277 ATCTCTACAAAAAATTTAGCTGG - Intergenic
1064665869 10:17650761-17650783 CTCTCTAGAAATATTTTAAACGG - Intronic
1064684974 10:17851277-17851299 ATCTTATCAATAATTTTTAATGG - Intronic
1065489974 10:26272948-26272970 AATTCTAGGATAATTTTAAATGG - Intronic
1065598685 10:27345937-27345959 GTCTCTACAATATTTTAAAGGGG + Intergenic
1065842377 10:29713379-29713401 ACCACTAAAATAATTTTAACAGG + Intronic
1066166748 10:32796899-32796921 ATATTTAAAATAATTTTAAAAGG - Intronic
1066342004 10:34544104-34544126 AGCTATAAAATAAATTTAAAAGG + Intronic
1066528882 10:36314371-36314393 ACCATTACAATAATTTTAATGGG - Intergenic
1066593209 10:37018897-37018919 TTCTCTCCAATTATTTTAACAGG + Intergenic
1067856238 10:49795997-49796019 ATCTCTTCAAATATTTTACAGGG - Intergenic
1068265786 10:54647485-54647507 AACTTTAAAATATTTTTAAAAGG + Intronic
1068742469 10:60489779-60489801 ATGTTTACATTATTTTTAAAAGG - Intronic
1069030095 10:63587182-63587204 ATCACAATAATAATTTAAAATGG + Intronic
1069063177 10:63915218-63915240 ATCTTCACAAAAATTTAAAAGGG + Intergenic
1069143237 10:64855178-64855200 ATCTAATCCATAATTTTAAAAGG + Intergenic
1069585698 10:69600013-69600035 ATCTCTTCAAATATTTTACAGGG + Intergenic
1070346718 10:75550816-75550838 ATCACTAGAACATTTTTAAAAGG - Intronic
1071025697 10:81110321-81110343 ATTTGTACATTAATTTTTAAAGG + Intergenic
1071074006 10:81729980-81730002 ATCTCTTCAAATATTTTACAGGG - Intergenic
1071306291 10:84301945-84301967 AAGTCAACAATAATTTTTAATGG + Intergenic
1071445280 10:85740587-85740609 ATCTCTAGAATGATATTGAAAGG - Intronic
1071732422 10:88261669-88261691 ATCTCTACAATAATCCTAAAGGG - Intergenic
1071804285 10:89099832-89099854 GTTTCTAAATTAATTTTAAATGG + Intergenic
1071866559 10:89740825-89740847 AACAATACAATAAATTTAAAAGG - Intronic
1072096251 10:92183789-92183811 ATTTCTAGAATAATAATAAAGGG + Intronic
1072972782 10:100031481-100031503 GTCTCTACAAAAACTTTAAAAGG + Intergenic
1073663771 10:105507450-105507472 CTCACTAAAATAATTTTTAAGGG - Intergenic
1074714438 10:116205273-116205295 ATCCCAATAAAAATTTTAAAAGG + Intronic
1075074286 10:119340487-119340509 ATTTCCAAAACAATTTTAAAAGG + Intronic
1075186674 10:120266168-120266190 ATCTCTAAAATGATGTCAAAAGG + Intergenic
1075922226 10:126223515-126223537 ATCTATATAAAATTTTTAAAAGG + Intronic
1078703000 11:13707664-13707686 ATTTCTACTTTAATTTTTAAGGG + Intronic
1079217834 11:18530038-18530060 ATCATTACATTAATTATAAAAGG - Exonic
1079539758 11:21559008-21559030 ATCTTTTCTATAATTTTCAAAGG + Intronic
1079662480 11:23057155-23057177 ATGTCTAGAATCATTTGAAAGGG - Intergenic
1079956432 11:26871724-26871746 ATCACTATACTAATTTTCAAAGG - Intergenic
1080327991 11:31100437-31100459 AACTCAACAACAATTTTCAAAGG + Intronic
1080339152 11:31238388-31238410 ATCACTAATATCATTTTAAAAGG + Intronic
1080352909 11:31405625-31405647 ATCTCTACAACAAATTTTCATGG - Intronic
1080775946 11:35386936-35386958 ATCTCTACAACAAATAAAAAAGG - Intronic
1080807427 11:35666754-35666776 ATCTCTAAAATAAAAATAAATGG + Intronic
1081325153 11:41735582-41735604 GTATCTAAAATATTTTTAAATGG - Intergenic
1081479706 11:43474377-43474399 ATCTTAAAAATATTTTTAAATGG + Intronic
1081522905 11:43899933-43899955 ATATCTACAGTTATTTGAAAAGG + Intronic
1082830809 11:57615768-57615790 ATCTTCACAATAAATTTATATGG + Intergenic
1084476393 11:69391959-69391981 CTCACTACACTGATTTTAAAGGG + Intergenic
1085068019 11:73515540-73515562 ATCTATTAATTAATTTTAAAAGG + Intronic
1085369859 11:75991489-75991511 ATCACTACAATAACTTTATGAGG + Intronic
1085895093 11:80629432-80629454 TTCTCTCCAATTATTTTAACAGG - Intergenic
1086048204 11:82558043-82558065 ATCTTTACAATAATCCTAAAAGG + Intergenic
1086218654 11:84414176-84414198 ATCTTCACAATAGTCTTAAAAGG - Intronic
1086224700 11:84493845-84493867 ATCTCTTCAATAATTTTATCAGG + Intronic
1086315767 11:85589901-85589923 ATTTTTACAATAATTTTGACTGG - Intronic
1086331422 11:85758176-85758198 ATTACTACAAGATTTTTAAATGG + Intronic
1086445793 11:86868979-86869001 ATCTCTACAAAAAATACAAAAGG - Intronic
1086933270 11:92716810-92716832 ATCTCTACTACAATCATAAAGGG - Intronic
1087091624 11:94279492-94279514 ATAGTTACAATCATTTTAAATGG - Intergenic
1087245550 11:95831884-95831906 ATATCTATAAAAATTATAAAAGG + Exonic
1087287203 11:96277761-96277783 CTTTCTAAAATAATTTAAAATGG + Intronic
1087442117 11:98199733-98199755 AAATCTACAAAAATTTCAAACGG - Intergenic
1087575021 11:99979053-99979075 ATCTTTACATCAATTTCAAAAGG - Intronic
1087662703 11:101006264-101006286 ATGTCTACTAAAAGTTTAAATGG - Intergenic
1088050320 11:105506462-105506484 ACCTCCACAATAATTTTAATAGG + Intergenic
1089476668 11:118769121-118769143 ATCTCTACAAAAATTTTTAAAGG + Intronic
1090535296 11:127634641-127634663 ATCATTATAATAATTTTACATGG - Intergenic
1091097024 11:132833522-132833544 CTCTCTAAAATAATGATAAAAGG + Intronic
1091824064 12:3496637-3496659 ATCTTCACAACAATCTTAAAAGG - Intronic
1091855851 12:3739445-3739467 ATGTATTCATTAATTTTAAAAGG - Intronic
1092144692 12:6206390-6206412 GTCTCTACAAAAAAATTAAAAGG - Intronic
1092853589 12:12652731-12652753 ATCTCTACAAAAAAATTAACTGG - Intergenic
1093367042 12:18315629-18315651 ATCTTTTCAATAATTCTATAAGG + Intronic
1093506799 12:19876307-19876329 TTCTCTACAATCTTTTTCAAAGG - Intergenic
1093806682 12:23441768-23441790 AAGTGTACAATAATTTAAAAAGG - Intergenic
1094147076 12:27241976-27241998 ATATCTACAACAACTTTAATGGG - Intergenic
1094324781 12:29225352-29225374 ACCTTTACAATAATCTTAAAAGG - Intronic
1094444735 12:30517439-30517461 ATCTCTACCATAATTTGACTTGG - Intergenic
1094570257 12:31635346-31635368 ATTTTTAAAATAAATTTAAAAGG - Intergenic
1095315473 12:40755705-40755727 GTCTCTACAAAAATTAAAAAGGG + Intronic
1095409488 12:41906657-41906679 TGCTCTACAACATTTTTAAAAGG + Intergenic
1095770215 12:45946151-45946173 TTCTCTACAATGACTTAAAATGG + Intronic
1096249077 12:50015499-50015521 ATCTCTACAAAAAATTTTTAAGG + Intronic
1096568746 12:52505356-52505378 ATATCAATAATAACTTTAAATGG - Intergenic
1096723785 12:53544902-53544924 TTCTCAAAAATAGTTTTAAAAGG + Intronic
1097157095 12:57020254-57020276 ATCTCTACAAAAAGTTTTAAAGG + Intronic
1097356645 12:58609631-58609653 ATCACTTTAAGAATTTTAAATGG - Intronic
1097463329 12:59890864-59890886 TTATCTATAACAATTTTAAAAGG + Intergenic
1097989659 12:65822214-65822236 ATTTTTAAAATAATGTTAAATGG - Intergenic
1098031510 12:66259261-66259283 ATTCCTACAATGATTTTAAAGGG + Intergenic
1098404573 12:70109842-70109864 ATTTTTACATTAATTTTATAGGG - Intergenic
1098406359 12:70130953-70130975 ATCTATAAAAATATTTTAAATGG - Intergenic
1098662307 12:73111160-73111182 TTCTCTACAATAAGTTAATAAGG - Intergenic
1098728077 12:73994907-73994929 ATCCCAAGAATAATTGTAAAGGG + Intergenic
1098913968 12:76238456-76238478 ATTTATACAACATTTTTAAAAGG - Intergenic
1099173218 12:79390446-79390468 AATTCTACAATTTTTTTAAAAGG + Intronic
1099473701 12:83081977-83081999 ATCTCTAAAAAAAATTTAAATGG + Intronic
1099474963 12:83096859-83096881 ATCTCAACAATTATTTTCTAGGG + Intronic
1099585796 12:84511238-84511260 ATCCCTATAATAATGATAAAAGG - Intergenic
1099600297 12:84727040-84727062 ATCACTATAATTATTCTAAAAGG + Intergenic
1099708176 12:86183965-86183987 TTCTCTTCAATATTTTTAAATGG - Intronic
1100185199 12:92131071-92131093 TTCTCTACACTAATTTAAGAAGG + Intronic
1101006087 12:100402124-100402146 ATCTTTACAATATTTCCAAATGG - Intronic
1101211282 12:102537661-102537683 ATATATACAATAATTAGAAAAGG + Intergenic
1101548112 12:105735846-105735868 CTCTGTACAATATTGTTAAAGGG + Intergenic
1102385236 12:112503608-112503630 CTCTCTGCAATAATTTGCAATGG + Intronic
1103078688 12:118006034-118006056 ATCTGTACAAAAAATTTAAAAGG + Intergenic
1103787063 12:123440604-123440626 ATCTCTACAAAAAGTAAAAATGG + Intergenic
1104195166 12:126530180-126530202 TTCTCTAAAATAATTGCAAAAGG + Intergenic
1106228640 13:27804382-27804404 ATATCCACAATTATATTAAAAGG + Intergenic
1106432535 13:29694724-29694746 ATCTCTAAAAAAAATTTAAAAGG - Intergenic
1106954583 13:34922167-34922189 GTCTCTACTAAAATTATAAAAGG - Intergenic
1106970441 13:35134880-35134902 ATCTGTCCTATAATTTGAAAAGG - Intronic
1107201120 13:37719063-37719085 ATGTCAGCAATAATTTTAATTGG - Intronic
1107206043 13:37789995-37790017 ATCTCTACAAAATTATAAAAAGG + Intronic
1107281742 13:38744370-38744392 ATCTCTACAAAAAAATTAACTGG - Intronic
1107396581 13:40024435-40024457 ATTTCAACATTAATTTTAACAGG + Intergenic
1107528811 13:41261880-41261902 AGCTCTACAGTTATATTAAATGG + Intronic
1107631348 13:42345817-42345839 ATCTATATAATTCTTTTAAATGG + Intergenic
1107727387 13:43312747-43312769 ATTTCCAGAATAATTTTTAAGGG + Intronic
1108310701 13:49186908-49186930 CTCTCTATAACAATTTTTAATGG - Intronic
1108486480 13:50931691-50931713 ATATCCACAATAATCTAAAAAGG - Intronic
1108511112 13:51156648-51156670 GTCTTTACAATAATCTTATATGG - Intergenic
1108762736 13:53589267-53589289 TTTTTTAAAATAATTTTAAAGGG + Intergenic
1108900560 13:55401377-55401399 ATATCTATAATAAATTTGAATGG - Intergenic
1108991938 13:56670399-56670421 ACCTCTAAAATAATTTTTAAAGG + Intergenic
1109990967 13:70057339-70057361 ATTTCTACAAAACCTTTAAATGG + Intronic
1109995069 13:70112346-70112368 TTCTATATAATTATTTTAAATGG - Intergenic
1110139342 13:72108271-72108293 AATTGTACAATAATTTTAATAGG - Intergenic
1110348126 13:74472632-74472654 ATCTATACAACAATTTGTAAAGG - Intergenic
1110388260 13:74940237-74940259 AGATCTATAAAAATTTTAAAAGG + Intergenic
1110861614 13:80350418-80350440 ATCCCAGCACTAATTTTAAATGG + Intergenic
1111091336 13:83452085-83452107 AGCTCAACAAAAATTTAAAAAGG + Intergenic
1111205169 13:84998005-84998027 ATGTAGACAATGATTTTAAAAGG + Intergenic
1111274142 13:85925827-85925849 CTCCCATCAATAATTTTAAATGG - Intergenic
1111279033 13:85994167-85994189 ATACCTACAATAATTTTACAAGG - Intergenic
1111335856 13:86821590-86821612 ATAGCTACAGTAATTTTTAAGGG + Intergenic
1111460099 13:88528093-88528115 ATCTCTACAATTGTTTTTTAAGG + Intergenic
1111480149 13:88813547-88813569 TCCTCTACAAAAATTGTAAAGGG + Intergenic
1111893684 13:94114839-94114861 ATCTTCATAATAATTCTAAATGG + Intronic
1112428087 13:99323233-99323255 ATCTCTAAAGTAAGTTTAACTGG - Intronic
1112897704 13:104320828-104320850 ATCTGTACATTTATTTTAATTGG + Intergenic
1113002437 13:105657699-105657721 TTCTCTATCAAAATTTTAAAGGG + Intergenic
1113292035 13:108917769-108917791 ACTTCTACATTACTTTTAAATGG + Intronic
1113485605 13:110650396-110650418 ATCTCTACAAAAAATACAAAAGG - Intronic
1113601405 13:111571688-111571710 GTCTAAACAATAATTTTTAATGG - Intergenic
1114128903 14:19765717-19765739 ATCTCTACCAAAAGTTTACAAGG + Intronic
1114135872 14:19849533-19849555 ATCTCTAAAAAGATTGTAAAAGG + Intergenic
1114943927 14:27654398-27654420 ATTTCTACATTTTTTTTAAACGG + Intergenic
1115343529 14:32318084-32318106 ATCTTTATAATAATTTTGTAAGG + Intergenic
1115468982 14:33748212-33748234 ATCTCTAAACTTCTTTTAAAGGG - Intronic
1115839600 14:37453598-37453620 ATGTGTACAATAATTTTGAAAGG - Intronic
1115848121 14:37560041-37560063 AACTGTATAATATTTTTAAAAGG + Intergenic
1115861365 14:37689316-37689338 ATCTATAAAATAATCTCAAAAGG + Intronic
1116346431 14:43801152-43801174 TTCTCAATAAAAATTTTAAATGG + Intergenic
1117007989 14:51441835-51441857 ATATTTACAGTAATTTTCAAAGG - Intergenic
1117085246 14:52194241-52194263 ATATCTAAACTAATTTTAGAAGG - Intergenic
1117203906 14:53420474-53420496 ATATAAACAACAATTTTAAAAGG + Intergenic
1117266739 14:54096699-54096721 ATCTCTAGTATAATGTTGAATGG - Intergenic
1117397139 14:55321898-55321920 ATTTCAAAAACAATTTTAAACGG - Intronic
1117453103 14:55871564-55871586 AAATCTACAATTATCTTAAAAGG - Intergenic
1117456547 14:55903160-55903182 ATCCTTACAATAACTTTACAAGG - Intergenic
1117625347 14:57631359-57631381 ATGGCAAAAATAATTTTAAAGGG + Intronic
1117637354 14:57758306-57758328 AACTGTACAACAATTTCAAAAGG - Intronic
1118488440 14:66235698-66235720 ATCTCTACAAAAATCTAAAAAGG - Intergenic
1118985559 14:70751812-70751834 ATCTCTACAACAATTCTGATAGG + Intronic
1119487205 14:74997596-74997618 ATCTCTACAAAAAATACAAAAGG + Intergenic
1119970682 14:78966651-78966673 TTTTCTTCAATAGTTTTAAAGGG - Intronic
1120228199 14:81814443-81814465 GACTTTACAATGATTTTAAAGGG + Intergenic
1121904669 14:97728743-97728765 ATCTTTATAATAATGCTAAATGG - Intergenic
1121966278 14:98309199-98309221 ATGTCTAGAATTATCTTAAAAGG + Intergenic
1122480952 14:102046960-102046982 ATCTCTACAAAAAATTAGAAAGG - Intronic
1123571851 15:21619929-21619951 ATCTCTACCAAAAGTTTACAAGG + Intergenic
1123608466 15:22062523-22062545 ATCTCTACCAAAAGTTTACAAGG + Intergenic
1123905037 15:24912596-24912618 ATTTCCACACTAATTTTAGAAGG - Intronic
1124393908 15:29283876-29283898 ACCTCTACTAAATTTTTAAATGG - Intronic
1124683511 15:31757782-31757804 TTCTATAGAATTATTTTAAAGGG - Intronic
1124840690 15:33238891-33238913 ATCTAAACAATAATTTTCCATGG - Intergenic
1125187334 15:36946017-36946039 ATTTCCAGATTAATTTTAAAAGG - Intronic
1125717135 15:41825768-41825790 ATCCCTGCAGTAATTTCAAATGG - Exonic
1125815742 15:42582441-42582463 ATCTCTACACTCACTTTAATGGG - Intronic
1125915229 15:43480830-43480852 ATCTGCACAATCATGTTAAAGGG + Intronic
1126645916 15:50874725-50874747 ATCTCTTCAAATATTTTACAGGG - Intergenic
1126648785 15:50901170-50901192 ATATCTACAATTATTTGAAAGGG - Intergenic
1126660469 15:51028358-51028380 ATAACTACAACAATTTTTAAAGG - Intergenic
1126732009 15:51693293-51693315 ATCTCTTGAATAATATAAAAAGG - Intronic
1126989364 15:54354842-54354864 ATCTCAACATGAATTTTAGAGGG - Intronic
1127083217 15:55400503-55400525 ATCTCAAAAATAAATTAAAAAGG + Intronic
1127106110 15:55618000-55618022 AACACTAGAATAACTTTAAAAGG + Exonic
1127163623 15:56219348-56219370 ATATTTACAATAAATATAAAAGG - Intronic
1127864926 15:63024591-63024613 ATCTCTAAAATACATTAAAAAGG + Intergenic
1128359969 15:66955150-66955172 ATCTCTGCAAGTATTTTATAAGG + Intergenic
1128433039 15:67618005-67618027 ATTTCTAGAATAATCTTTAAAGG - Intronic
1128564149 15:68688834-68688856 ACCTCTCCAACACTTTTAAAAGG - Intronic
1129258662 15:74349778-74349800 GCCTCTAATATAATTTTAAAAGG - Intronic
1129373441 15:75112121-75112143 GTCTCTATAAAAAATTTAAAAGG + Intronic
1130046859 15:80452552-80452574 ACATTTAAAATAATTTTAAAAGG - Intronic
1131599900 15:93836749-93836771 CTCTCTAACATATTTTTAAATGG - Intergenic
1131611072 15:93964611-93964633 TTCTCTCGAATAATTTGAAAAGG - Intergenic
1131815289 15:96215617-96215639 ATCTCTACAAAAAATTTAAAAGG - Intergenic
1132187282 15:99812130-99812152 ATCTCCACAATAATCTAAAATGG - Intergenic
1132428395 15:101740610-101740632 ATCTCCACAATGATCTAAAATGG + Intronic
1202980706 15_KI270727v1_random:354319-354341 ATCTCTACCAAAAGTTTACAAGG + Intergenic
1132559787 16:588360-588382 ATCTCTACAAAAAATACAAAAGG + Intergenic
1133746956 16:8694544-8694566 ATCTCTACAAAAAATAAAAAAGG - Intronic
1133832610 16:9337938-9337960 ACCTTTTCAATAATTTTAAAAGG + Intergenic
1134230578 16:12426010-12426032 TCCTATAAAATAATTTTAAAAGG - Intronic
1134361093 16:13531796-13531818 ATCCTTATAATAATTTTAAGAGG - Intergenic
1135256626 16:20946524-20946546 ATCTCTTCAAATATTTTACAGGG + Intronic
1136138513 16:28273600-28273622 ATCTCTACAAAAAAATGAAATGG - Intergenic
1136426505 16:30171242-30171264 GTCTCTACAAAAAATTTAAAAGG - Intergenic
1137907883 16:52342976-52342998 ATCTATAGAATAATGTCAAAAGG + Intergenic
1138049058 16:53756594-53756616 ATCTCTGCAACTCTTTTAAAAGG - Intronic
1138218141 16:55223723-55223745 ATCTTTACAACAATCTTACAAGG + Intergenic
1138389010 16:56656968-56656990 ACCTTTACAACAATTGTAAAGGG - Intronic
1138550477 16:57745062-57745084 ATTTCTACAATTAATTTCAATGG + Intronic
1139013784 16:62665104-62665126 CTCTATAAAATATTTTTAAAAGG - Intergenic
1140146192 16:72311875-72311897 ATCTTCACAATAATTTCATAAGG + Intergenic
1140263313 16:73399195-73399217 AGCCCTACAAAAATGTTAAAGGG + Intergenic
1140867992 16:79080796-79080818 ATCTCTAAAAGAATTTTTTAAGG + Intronic
1141053699 16:80796540-80796562 ATGTCTTCAGTAATTTTAATTGG - Intronic
1141904933 16:87018359-87018381 ATCCCAACAATAATGTTAGAGGG + Intergenic
1142320485 16:89379320-89379342 TTTTATAAAATAATTTTAAATGG + Intronic
1142629046 17:1212258-1212280 ATCTCTACAAAAGTTTTATAAGG + Intronic
1142689360 17:1595743-1595765 ATCTCTACAAAAATAATTAAAGG - Intronic
1142694214 17:1624404-1624426 ATCTCTACAAAAAATTTGACCGG + Intronic
1143288957 17:5814415-5814437 ATTTCTAAAATGATTTTAATGGG + Intronic
1143674844 17:8424835-8424857 GTCTCTACAAAAAATGTAAAAGG - Intronic
1144000440 17:11049217-11049239 ATCATTATAAGAATTTTAAAAGG + Intergenic
1144293472 17:13850298-13850320 CTCTCTAAAAAAATTTTAAAAGG + Intergenic
1144410289 17:14994214-14994236 TTCTCTACATTTATTTTATAAGG + Intergenic
1144517812 17:15931146-15931168 ATCTCTACAAAAAATTTAAAAGG + Intergenic
1145005458 17:19335045-19335067 AACTCTAAGAAAATTTTAAAAGG + Exonic
1146189699 17:30753847-30753869 ATCTCTACAAAAAGTACAAAAGG - Intergenic
1146334598 17:31958202-31958224 ATCTCTACAAAAAGTACAAAAGG - Intronic
1146868128 17:36356082-36356104 AGCTCAACAATACTTTTAACTGG + Intronic
1147071002 17:37956700-37956722 AGCTCAACAATACTTTTAACTGG + Intergenic
1147082528 17:38036226-38036248 AGCTCAACAATACTTTTAACTGG + Intronic
1147098472 17:38160194-38160216 AGCTCAACAATACTTTTAACTGG + Intergenic
1148292264 17:46463913-46463935 CCCTCAACAAAAATTTTAAATGG - Intergenic
1148314449 17:46681605-46681627 CCCTCAACAAAAATTTTAAATGG - Intronic
1148571856 17:48676784-48676806 ATATCCACAATTATTTGAAAAGG - Intergenic
1149277657 17:55062064-55062086 ATCTCTACAATTATCTTAAAAGG + Intronic
1149453396 17:56767626-56767648 ATGTATCAAATAATTTTAAATGG + Intergenic
1150986040 17:70198054-70198076 ATCTCTTCGATATTTTTGAATGG + Intergenic
1203171597 17_GL000205v2_random:153550-153572 ATTTCTACAAGAATGTAAAAAGG + Intergenic
1203174149 17_GL000205v2_random:179224-179246 ATTTCTACAAGAATGTAAAAAGG - Intergenic
1153353871 18:4113156-4113178 ATTTCTCAAATAATTTAAAACGG - Intronic
1153511441 18:5858049-5858071 CTTTCTACACTAATTTTAGAAGG + Intergenic
1154273992 18:12944083-12944105 ATGAATAAAATAATTTTAAAAGG + Intergenic
1154459961 18:14573007-14573029 ATCTCTAAAAATATTGTAAAAGG + Intergenic
1155591489 18:27432836-27432858 ATTTCAACAAGAGTTTTAAAAGG - Intergenic
1155752759 18:29449257-29449279 ATATCTCCATTAATTTTTAAAGG + Intergenic
1156023473 18:32625527-32625549 ATCTCTAAAATGCTTTTAATTGG - Intergenic
1156615155 18:38774403-38774425 ATCTCTTCAAAAATATTGAAAGG - Intergenic
1156633976 18:39005304-39005326 ATTTCTACTATAATTATATAGGG + Intergenic
1156955813 18:42962324-42962346 AGTTTTAAAATAATTTTAAATGG - Intronic
1157466248 18:47948685-47948707 ATTTCAACAAGAATTTTAGAGGG + Intergenic
1158024423 18:52878868-52878890 ATCAGTAGAATAATTTTGAAGGG + Intronic
1158027370 18:52916729-52916751 ATCTCTACAATTATGTGAAAAGG + Intronic
1158106312 18:53888654-53888676 ATCTCTACAAAAAATTTAGCTGG + Intergenic
1158203219 18:54962611-54962633 AGCTCTAGGAAAATTTTAAATGG - Intergenic
1158730368 18:60016397-60016419 ATTTCTACAGTAGTTTTGAATGG - Intergenic
1159139394 18:64374128-64374150 TTCCCCAAAATAATTTTAAAAGG + Intergenic
1159298298 18:66525184-66525206 ATCTTAACAATAATATTAAGTGG - Intronic
1159448989 18:68576065-68576087 AACTATATAATAATTTTAACAGG + Intergenic
1159468730 18:68821831-68821853 TTCTCTACAATTATATTAAATGG - Intronic
1159489605 18:69114360-69114382 AATTCTTCAATAATTTTAAAAGG + Intergenic
1159494539 18:69184897-69184919 ATATCAATAATAATGTTAAATGG - Intergenic
1159517279 18:69473756-69473778 ATCTATGTAATGATTTTAAATGG + Intronic
1159721159 18:71892945-71892967 ATTTCAACATTTATTTTAAAGGG + Intergenic
1159843018 18:73422700-73422722 ATCTCTCCAGTACTATTAAAAGG + Intergenic
1160116447 18:76083676-76083698 ATCTCTACAGTTATTCTTAAAGG - Intergenic
1160971585 19:1770085-1770107 ATCCTTACAATAATTCTACAAGG - Intronic
1162113232 19:8412843-8412865 GTCTCTACAAAAAATTTAAAAGG - Intronic
1163409383 19:17144211-17144233 ATCTCAAAAATAATATTAAAAGG + Intronic
1163456213 19:17407227-17407249 GTCCCTACAGTAATTTTAAAGGG - Intronic
1163809972 19:19424943-19424965 ATCTCTACAAAAAATAAAAAAGG + Intronic
1164975583 19:32570728-32570750 ATCTCTGCAAAAATTTAAACAGG - Intergenic
1167797900 19:51721900-51721922 GTCTCTACAACAATCTTATAAGG + Intronic
1168328479 19:55551393-55551415 ATCTCTACAAAAAACTTAAAAGG - Intergenic
925605022 2:5650835-5650857 ATCTCCACAATAATATTCCAAGG + Intergenic
926527569 2:14000522-14000544 CTTTCTACAATAAGTTTAAAAGG - Intergenic
927365296 2:22287939-22287961 ATCTATATAATATTGTTAAATGG + Intergenic
928641836 2:33307124-33307146 AGCTCTACAACTATTTTAATGGG - Intronic
930131281 2:47853686-47853708 ATCTTCACAGTAATTTTATAAGG - Intronic
930433541 2:51312446-51312468 ACCTCTACCACAATTTTGAAAGG - Intergenic
930502714 2:52243162-52243184 ATATTAACAATAATTTAAAAAGG + Intergenic
930750924 2:54933429-54933451 ATATATAGAATAGTTTTAAATGG - Intronic
930925657 2:56815766-56815788 ATGTTTATAATAATTTTAACTGG + Intergenic
931064010 2:58564091-58564113 AACTCTAAAATAATTTTATCAGG - Intergenic
931287491 2:60845033-60845055 ATCTTTTCCATAAATTTAAAAGG + Intergenic
931651227 2:64470752-64470774 ATCCTTACAATAATCTTATAAGG - Intergenic
931853009 2:66272376-66272398 AACACACCAATAATTTTAAATGG + Intergenic
931913609 2:66928971-66928993 ATCTGTACTATAATTGTAGATGG + Intergenic
932031697 2:68193485-68193507 ATATCCAGAATATTTTTAAATGG + Intronic
933001559 2:76930768-76930790 ATCTGTAAAATAATGATAAATGG + Intronic
933520566 2:83366982-83367004 ATTTATACAAAATTTTTAAAAGG + Intergenic
933551203 2:83778461-83778483 ATATCTAAAATAATTATACAAGG - Intergenic
934150291 2:89141447-89141469 ACTTCTACAAATATTTTAAAAGG - Intergenic
934217002 2:90040586-90040608 ACTTCTACAAATATTTTAAATGG + Intergenic
934844812 2:97656019-97656041 ATATGTACAATAATTTAACACGG - Exonic
935020322 2:99224075-99224097 ATCTCAAAAAAATTTTTAAAAGG - Intronic
935526655 2:104179089-104179111 GTATCTACAATAATTTTTAAGGG - Intergenic
936226596 2:110659802-110659824 ATTTCTACATTTATTTGAAATGG + Intronic
936596730 2:113855236-113855258 ATCTCTCCAATATTCCTAAATGG - Intergenic
936707003 2:115086908-115086930 ATCTCTTCAAATATTTTACAGGG + Intronic
937512834 2:122616927-122616949 ATCTGTAGAATATTTGTAAAAGG - Intergenic
937515650 2:122652305-122652327 ATCTTTACAATGATTCTACAAGG - Intergenic
938591755 2:132745568-132745590 ACCTCCACTATAATGTTAAATGG - Intronic
938713598 2:133998149-133998171 CTTTCTCCAATAAATTTAAAAGG + Intergenic
939324939 2:140676035-140676057 ATTACTACAATAAATTTAAAAGG + Intronic
939412479 2:141847400-141847422 AACTCTGCAAGGATTTTAAATGG - Intronic
939764796 2:146233587-146233609 ATCTCCACATTAATTCTAACTGG - Intergenic
939768442 2:146283900-146283922 ATATCTTCAACCATTTTAAAAGG - Intergenic
939901908 2:147860613-147860635 ATCTCTACCTTAATTTGGAATGG + Intronic
939915545 2:148038411-148038433 ATCTCTACAAAAACTTTTCAGGG + Intronic
940029217 2:149242917-149242939 AATACTAAAATAATTTTAAATGG - Intergenic
940123981 2:150302839-150302861 TTTTCTATATTAATTTTAAAAGG - Intergenic
940144791 2:150534438-150534460 ATCTTTACAATATCTTTTAAAGG + Intronic
940146473 2:150550411-150550433 GTCTGTACCATAATTTTAACTGG - Intergenic
940463105 2:153993180-153993202 ATATATACAATAGTTGTAAATGG - Intronic
940550719 2:155152406-155152428 GTATCTACCACAATTTTAAAGGG + Intergenic
940793989 2:158057800-158057822 ACTTCTACAAAAATTTTTAATGG - Intronic
941313679 2:163966067-163966089 ATCTTTACAATAACTTTATAAGG - Intergenic
942084926 2:172434862-172434884 AACTTTGCAATAATTTGAAAGGG + Intronic
942542221 2:177026193-177026215 ATCTATACAATAACTCTACAAGG + Intergenic
942801111 2:179877005-179877027 ATCTCTGCAATAATTTAACTTGG + Intergenic
943021793 2:182583324-182583346 ATCTTTATAATAATTTTAAGTGG - Intergenic
943170408 2:184390359-184390381 AATTCAACAATAAATTTAAAAGG + Intergenic
943394316 2:187313745-187313767 AAATATACAATAATTTTAAATGG + Intergenic
943613590 2:190065455-190065477 ATATTTACCACAATTTTAAAAGG + Intronic
944044549 2:195393959-195393981 ATCTTTACAAAAATTTTAAGAGG + Intergenic
944078654 2:195759843-195759865 ATCTCTACAATTTTTTTTAAGGG - Intronic
944119798 2:196228698-196228720 ATATCTGAAATATTTTTAAATGG + Intronic
944687546 2:202131073-202131095 ATGTCTACATTAATTTTCAAAGG - Intronic
945076248 2:206042814-206042836 ATCTCTACAAAAATTTAAAATGG + Intronic
945282807 2:208052025-208052047 ATAACTATAATATTTTTAAAAGG + Intergenic
945412605 2:209529607-209529629 ATTTTTAGAATAATTATAAAGGG - Intronic
945528325 2:210918039-210918061 ATCTGAAAAAAAATTTTAAAAGG + Intergenic
945629887 2:212260847-212260869 GTCTCTATAATGGTTTTAAATGG + Intronic
945732486 2:213555884-213555906 ATAGCTAAAATAATTTTTAAGGG + Intronic
946620026 2:221551586-221551608 ACTTTTTCAATAATTTTAAATGG - Intronic
946643747 2:221811741-221811763 ATCTCAAGAATGATTTTAGAAGG - Intergenic
946995934 2:225391096-225391118 ATTTTTACAATAATTTTATATGG - Intergenic
947577534 2:231287755-231287777 ATTTCTACACTAATTTTGAAAGG - Intronic
948062838 2:235054189-235054211 ATCTCTAACATAATTTAAAAAGG - Exonic
948470936 2:238178355-238178377 ATCTCTACAAAAAATAAAAATGG - Intronic
1168833071 20:858006-858028 ATCTCTACAAAAATATAAAATGG - Intergenic
1168873237 20:1149197-1149219 ATATCTAGAATTATTTGAAAAGG - Intronic
1169184322 20:3601236-3601258 ATCTATACAACAATTCTAAGAGG - Intronic
1169574816 20:6947507-6947529 ATTTATAAAATTATTTTAAATGG - Intergenic
1169673087 20:8125962-8125984 ATTTCTACAAAAATGTGAAAAGG + Intergenic
1169884382 20:10382354-10382376 ATCTTTATTATAATTTTACATGG - Intergenic
1170484396 20:16801672-16801694 ATATCTACAATTATTTGAAAAGG + Intergenic
1170680572 20:18521953-18521975 AACTCGACAATGATTCTAAATGG - Intronic
1170777379 20:19389177-19389199 ATATATACAATAATTTAATAAGG - Intronic
1170997932 20:21382807-21382829 ATCTGTAGAATAATTTTTAAAGG + Intronic
1171186034 20:23125054-23125076 AGCTTGACAATAACTTTAAATGG + Intergenic
1172457803 20:35091827-35091849 ATCTCCACAACAATCTTAAAAGG + Intronic
1172675532 20:36668323-36668345 ATCTCTACCATACTTTACAAGGG - Intronic
1174217153 20:48924851-48924873 ATCTTTACAATAATCCTATAAGG - Intronic
1174573046 20:51517007-51517029 ACTTGTACAATAATTGTAAACGG + Intronic
1174986370 20:55458092-55458114 TTCTCCAGAATAAATTTAAAGGG - Intergenic
1176064018 20:63184921-63184943 ATCTTTACATTAGTTTTACACGG + Intergenic
1176327575 21:5515382-5515404 ATTTCTACAAGAATGTAAAAAGG + Intergenic
1176330138 21:5540866-5540888 ATTTCTACAAGAATGTAAAAAGG - Intergenic
1176397619 21:6280085-6280107 ATTTCTACAAGAATGTAAAAAGG + Intergenic
1176400182 21:6305569-6305591 ATTTCTACAAGAATGTAAAAAGG - Intergenic
1176436975 21:6683535-6683557 ATTTCTACAAGAATGTAAAAAGG + Intergenic
1176439538 21:6709019-6709041 ATTTCTACAAGAATGTAAAAAGG - Intergenic
1176461237 21:7010605-7010627 ATTTCTACAAGAATGTAAAAAGG + Intergenic
1176463800 21:7036088-7036110 ATTTCTACAAGAATGTAAAAAGG - Intergenic
1176484798 21:7392383-7392405 ATTTCTACAAGAATGTAAAAAGG + Intergenic
1176487361 21:7417867-7417889 ATTTCTACAAGAATGTAAAAAGG - Intergenic
1176814154 21:13579819-13579841 ATCTCTAAAAATATTGTAAAAGG - Intergenic
1177235948 21:18390351-18390373 ATCTCTAACATAATATTAATAGG + Intronic
1177246049 21:18525537-18525559 ATATATGCAATAATTTGAAAAGG - Intergenic
1177257098 21:18678491-18678513 ATCTGTACCGTCATTTTAAATGG + Intergenic
1177624706 21:23645559-23645581 ATCTCTACAAAAAATACAAAAGG - Intergenic
1177943435 21:27439161-27439183 ATTTCTAGAATACTTTTACATGG + Intergenic
1178363641 21:31970243-31970265 AGCTCTAGAAAAACTTTAAAGGG + Intronic
1178471172 21:32894144-32894166 AACTCTACAGTAATTCTATATGG - Intergenic
1178772010 21:35514120-35514142 ATTTCCACAATAATCTAAAAAGG + Intronic
1178933389 21:36839115-36839137 TTCTCTACAATTAGATTAAATGG + Intronic
1180119275 21:45736011-45736033 ATCTTAAGGATAATTTTAAAAGG - Intronic
1180724813 22:17938961-17938983 ATTTCTACATGAATTTCAAAAGG - Intronic
1180930728 22:19589065-19589087 ATCTCTAAAAAAAATTAAAATGG - Intergenic
1181913063 22:26255891-26255913 AAGTTTACAATGATTTTAAATGG - Intronic
1183944707 22:41318577-41318599 GTCTCTACAAAAAATTTTAAAGG + Intronic
1185106610 22:48873473-48873495 CTCAATACAATGATTTTAAAAGG - Intergenic
950722494 3:14893514-14893536 GTCTTTACAAAAAATTTAAAAGG - Intronic
950981342 3:17309111-17309133 ATCTCTTAACTAATTTTTAAAGG - Intronic
951008088 3:17642625-17642647 ATCTCTACAATTGTTATCAAAGG + Intronic
951076889 3:18404832-18404854 AACTATAAAATATTTTTAAAAGG + Intronic
951158598 3:19387002-19387024 ATCTCTACAGTTCTCTTAAATGG + Intronic
951388975 3:22079425-22079447 ATCTTTTCTATAATTCTAAATGG + Intronic
951496213 3:23329849-23329871 ATCACTAAAATATTTTAAAAGGG - Intronic
951752624 3:26054405-26054427 ATCTCTCCAGTATTTTTAGAAGG - Intergenic
951792336 3:26500084-26500106 CCCTCTCCAATAATTTGAAATGG + Intergenic
951935674 3:28020151-28020173 ATCTTTAAAATATATTTAAATGG - Intergenic
952640971 3:35595430-35595452 ATTTTTACAGTAATTTTAAAAGG + Intergenic
953186896 3:40646376-40646398 CTTTCTACAAAATTTTTAAAAGG - Intergenic
953448891 3:42990195-42990217 ATCTCTACAAAAGTTTAAAAAGG + Intronic
953701940 3:45203285-45203307 ATCTCTACAAAAATTTTTTTAGG + Intergenic
954120904 3:48499341-48499363 CCCTCTACATTAAATTTAAATGG + Intronic
954669535 3:52281710-52281732 ATCGATACAATCATTTTGAATGG + Intronic
954777374 3:53032199-53032221 ATCTCTACTAAAAATATAAAAGG + Intronic
955546238 3:60033771-60033793 ATTTCAAAATTAATTTTAAATGG + Intronic
955717977 3:61850775-61850797 ATGTCTATTAAAATTTTAAATGG - Intronic
956306133 3:67828344-67828366 TTCTCTATAATTATTTTTAAAGG + Intergenic
957150275 3:76477610-76477632 ATTTTTAAAAAAATTTTAAAAGG + Intronic
957540589 3:81564009-81564031 ATTTCTACAGGAATTTTAGAGGG - Intronic
958497853 3:94867364-94867386 GTTTCCACAAAAATTTTAAATGG + Intergenic
958544725 3:95529958-95529980 AACTATGCAATAATTTAAAAAGG - Intergenic
959407233 3:105975431-105975453 ATCAATGCAATAATATTAAAAGG + Intergenic
959817298 3:110689702-110689724 GTCTCTACAAACATTTTAATTGG + Intergenic
960110986 3:113844403-113844425 ACATATACATTAATTTTAAAAGG - Intronic
960218051 3:115066895-115066917 AGCACTTTAATAATTTTAAATGG - Intronic
960504394 3:118475187-118475209 AGCTCTCCAATAAATTTTAATGG - Intergenic
960633624 3:119759668-119759690 ATATCTACAATAATTTGTTAAGG + Intronic
960828702 3:121820858-121820880 CTTACTACAATAATTTAAAATGG + Intronic
962047265 3:131773871-131773893 CTCTTTACAAATATTTTAAATGG + Intronic
962223546 3:133585205-133585227 ATCTCTACAATAAAATAAACAGG - Intronic
962313901 3:134346044-134346066 ATTTTTACAATTATTTTAGAAGG - Intergenic
962821252 3:139049427-139049449 ATCTCTACAAAAAATTTTAAAGG - Intronic
963167424 3:142219805-142219827 ATCTCTACAAAAATACAAAAAGG + Intronic
963315762 3:143757111-143757133 ATCTCTACCATAGTTTACAAGGG - Intronic
963377465 3:144486705-144486727 ATCTCTATATTAATTTGAGAAGG + Intergenic
963713673 3:148777580-148777602 ATCTCCATAATAATTTGAAATGG - Intergenic
963989091 3:151632617-151632639 TTCTCTACTATATTTGTAAAAGG - Intergenic
964262759 3:154858229-154858251 ATCTGAACAATAATTTTAAGGGG - Intergenic
964482422 3:157154658-157154680 GTTTCTGTAATAATTTTAAATGG - Intronic
964571888 3:158116735-158116757 ATCTCTACAACACTTTTCAGGGG - Intronic
964590005 3:158350703-158350725 TTCTCAAAAAAAATTTTAAATGG - Intronic
964591816 3:158372308-158372330 ATATAAACATTAATTTTAAATGG - Intronic
964929084 3:161993860-161993882 TTCACTATAGTAATTTTAAAAGG - Intergenic
965337677 3:167448098-167448120 AGCCCTAAAATAATTATAAATGG - Intronic
965565899 3:170117620-170117642 ATCTGTACAATAATCTTCTAAGG + Intronic
966096421 3:176209719-176209741 AGCTCTAAAATAATTTTGTATGG - Intergenic
966497759 3:180600429-180600451 ATGTCTATAATAATTTTTAGTGG + Intergenic
966631104 3:182076071-182076093 ATCTCTACATATCTTTTAAATGG - Intergenic
966718521 3:183037923-183037945 ACCGATACAAAAATTTTAAAAGG + Intronic
967748403 3:193085568-193085590 ATCTCAATAATGTTTTTAAAAGG - Intergenic
968021621 3:195396471-195396493 TTCTTTAAAATAATTTTATAAGG - Intronic
968347589 3:198023628-198023650 ATCTTTATAATATTTTAAAATGG + Intronic
968539755 4:1159879-1159901 ATTACTTCAATAACTTTAAATGG - Intergenic
970671288 4:18399355-18399377 ATCTTGATAATAATTTTATAGGG + Intergenic
970861320 4:20706216-20706238 ATCTCTAGAATAAAATTGAAAGG + Intronic
970992509 4:22229208-22229230 ATCTAAACAATAATTATCAATGG + Intergenic
971545743 4:27883329-27883351 ATCACTCAAATAATTTTAATGGG + Intergenic
971647268 4:29223881-29223903 ATCTCTACAATAAATTGATGAGG - Intergenic
971948983 4:33317942-33317964 ATTTCTACCATATTTCTAAATGG + Intergenic
972310152 4:37873992-37874014 ATTTTTTTAATAATTTTAAAGGG - Intergenic
972729314 4:41777522-41777544 TTCTCTACAATAGATTTAAAAGG + Intergenic
973595434 4:52483970-52483992 AACTCTATAAAAATTTTAAAAGG - Intergenic
973618001 4:52699098-52699120 ATATCTTCAATTATTTAAAAAGG + Intergenic
974544986 4:63291618-63291640 ATCTTTACAAAAATATTAAAAGG - Intergenic
974700471 4:65437969-65437991 ATTTCTGAAATATTTTTAAAAGG - Intronic
974996467 4:69165805-69165827 CTGTCTACTAGAATTTTAAATGG + Intronic
975009450 4:69330747-69330769 CTGTCTACTAGAATTTTAAATGG + Intronic
975094891 4:70446190-70446212 GTATCTATAATATTTTTAAAAGG - Intronic
975117052 4:70691512-70691534 ATCTTTACAATAACTTTGCAAGG + Intergenic
975317831 4:72976021-72976043 TTCTCTAAAAAAATTTTAAAAGG - Intergenic
975752324 4:77536561-77536583 ATCTCCACAACAAATTTATAAGG - Intronic
975964119 4:79948976-79948998 AGCTCTCCAATATTTTTAACAGG + Intronic
976518699 4:86001933-86001955 AAACATACAATAATTTTAAAAGG + Exonic
977343462 4:95789838-95789860 GACTCTACAATAATTTTAAAGGG + Intergenic
977597397 4:98898156-98898178 ATATCAACAATTATTTTTAAAGG + Intronic
977635426 4:99292802-99292824 ATCTCTACACTAAATATAGAGGG - Intergenic
977870731 4:102087972-102087994 ATCTTCACAATAATCTTAGATGG + Intergenic
978041437 4:104068800-104068822 AAATATACATTAATTTTAAATGG - Intergenic
978240476 4:106509225-106509247 CACTCTTCAATAATTTTAATGGG - Intergenic
978347911 4:107790742-107790764 ATCTTCTTAATAATTTTAAAAGG - Intergenic
978668349 4:111213888-111213910 ATCTTTTCCATAATTTAAAATGG - Intergenic
978688665 4:111481184-111481206 ATCATTACAATACTTTCAAAAGG - Intergenic
978932559 4:114333010-114333032 TTCTCTAAAATATTTTTAAAAGG + Intergenic
979110944 4:116755608-116755630 AGCTATAAAATTATTTTAAATGG + Intergenic
979958417 4:126985389-126985411 ATAGCTACAATAATTTTTAAGGG - Intergenic
980106921 4:128596623-128596645 ATATGTAAAACAATTTTAAAAGG - Intergenic
980438396 4:132810285-132810307 TTCTCTATAATATTTTTAACTGG - Intergenic
981365655 4:143899405-143899427 ATCTGTTCAATAATTCTATAAGG - Intronic
981375661 4:144012408-144012430 ATCTGTTCAATAATTCTATAAGG - Intronic
981699900 4:147597029-147597051 ATCTCTACAAGAAATACAAATGG - Intergenic
981840986 4:149111849-149111871 ATCACAAAAATCATTTTAAAGGG + Intergenic
981866457 4:149425859-149425881 ATCTGTATAATAGTTTGAAACGG - Intergenic
981871454 4:149491863-149491885 ATCTCTACCATTTTTTTCAAGGG + Intergenic
982284635 4:153722471-153722493 GTCTCAAAAATAATTTTAATTGG - Intronic
982335978 4:154238696-154238718 AGCACAAGAATAATTTTAAAAGG - Intronic
982489825 4:156015568-156015590 AGCTCAACACTATTTTTAAATGG + Intergenic
983439416 4:167762583-167762605 AACTCTAAATTAATATTAAAAGG - Intergenic
983744529 4:171181000-171181022 ATTTCAAAAATAACTTTAAAAGG - Intergenic
983898558 4:173107760-173107782 ATATTTGGAATAATTTTAAATGG + Intergenic
984139829 4:175990600-175990622 AACACTAAAATAAATTTAAAAGG + Intronic
984241000 4:177219165-177219187 AACTCTAAAATATTTTAAAAAGG - Intergenic
984387807 4:179086477-179086499 ATCTCTAAAGAATTTTTAAAAGG - Intergenic
984535706 4:180972714-180972736 ATCTTCTCAATAACTTTAAAAGG - Intergenic
984549930 4:181147787-181147809 ATATCAACATTTATTTTAAAAGG + Intergenic
984667449 4:182444083-182444105 ATGTCTACAGTAAATCTAAAAGG - Intronic
984954446 4:185031593-185031615 ATCTCTAAAAAGTTTTTAAAAGG + Intergenic
985118170 4:186612715-186612737 TTCTCTAAAAAAATTTTGAAAGG + Intronic
986186507 5:5446172-5446194 ATCTCTACAAAAAATTTAAAAGG - Intronic
986320405 5:6627444-6627466 CTCTTTACAATAAGTCTAAATGG - Intronic
986585021 5:9307149-9307171 ATCCCTTCAATGATTTTATATGG - Intronic
986685353 5:10271348-10271370 ATCTCTACAAAAAACTTAACCGG + Intergenic
987103269 5:14611871-14611893 ATTTCTGCAATAAATTAAAAGGG + Exonic
987160177 5:15133526-15133548 ATCGCTGAAATAATTTTAACAGG - Intergenic
987489935 5:18567224-18567246 ATCAATAAAAAAATTTTAAAAGG - Intergenic
987773143 5:22332008-22332030 ATCTATAAAATAACTTCAAAAGG + Intronic
988131104 5:27107077-27107099 AACTCTAAAATCAGTTTAAAAGG + Intronic
988748591 5:34171564-34171586 GTCTCTATAATAAGTTTACAAGG + Intergenic
989290694 5:39761791-39761813 ATCTCTACAAAAAAATTAACTGG + Intergenic
989468652 5:41788369-41788391 ATGACTACATTAATTGTAAATGG + Intronic
989603664 5:43223339-43223361 ATCCTTACAAGAATTTTAGAAGG - Intronic
989673779 5:43950298-43950320 ATTACTCCAATATTTTTAAAAGG + Intergenic
989816089 5:45739223-45739245 ATATTTTAAATAATTTTAAAAGG + Intergenic
990533236 5:56694646-56694668 ATATGTAAAATAATTTTTAATGG - Intergenic
990712261 5:58596412-58596434 CTCTCTACAATAATAGTAAAGGG - Intronic
991460880 5:66856856-66856878 GTCTTTAAAATAATTTGAAAAGG + Intronic
991513310 5:67404585-67404607 AACTCTAAAATAATTTTCAAAGG + Intergenic
992615107 5:78539999-78540021 GTCTCTACAAGAATTCTAAATGG + Intronic
992639719 5:78758832-78758854 ATCATTACAATATATTTAAAGGG - Intronic
992922925 5:81545956-81545978 TTCCCTAAAATAGTTTTAAAGGG + Intronic
993145417 5:84087256-84087278 ATCTTCACAACAATTTTAAGAGG + Intronic
993370913 5:87090972-87090994 ATGTTTATAATAATTTCAAAAGG - Intergenic
993687814 5:90961523-90961545 ATTTCAAGAATAATTTTATAGGG + Intronic
993977609 5:94501058-94501080 TTCACTACTATTATTTTAAATGG + Intronic
994361895 5:98861266-98861288 TTTTCTACAATACTATTAAAAGG + Intronic
994529734 5:100954297-100954319 ATCTCTACAAAAAATACAAAAGG + Intergenic
994769876 5:103967139-103967161 ATAGCTACACTATTTTTAAATGG - Intergenic
994785735 5:104159898-104159920 ATCTCAACAATAATTTCAACAGG + Intergenic
995058144 5:107785279-107785301 GTTTTTACAATAATTTTGAATGG + Intergenic
995265766 5:110157861-110157883 ATCTCATTACTAATTTTAAAGGG - Intergenic
995637243 5:114207600-114207622 ATTCCTACAATGATTTAAAAGGG - Intergenic
996047209 5:118886898-118886920 ATAACTCCAATAATTTTATAAGG + Intronic
996075570 5:119188660-119188682 ATCTTTCAAATGATTTTAAAAGG - Intronic
996236412 5:121136363-121136385 ATATTTACAATAATAATAAATGG + Intergenic
996511750 5:124324168-124324190 ATCTCCACAACAATCTTATAAGG - Intergenic
996633984 5:125668568-125668590 ATCCCTACAACAATCATAAAAGG - Intergenic
996853060 5:127974382-127974404 ATCTCAAAAATAATATTTAAAGG + Intergenic
997706097 5:135954209-135954231 TTCTTTAAAATACTTTTAAAAGG + Intronic
997953561 5:138260857-138260879 ATCTCTACAAAAAATTTAGCTGG + Intronic
998710805 5:144823037-144823059 TTTTTAACAATAATTTTAAAAGG - Intergenic
998853246 5:146370998-146371020 ATCCCCACAATAATTCTATAAGG - Intergenic
999480667 5:151945351-151945373 ATTTTTAAAATAATTTTAAGAGG + Intergenic
999684657 5:154091434-154091456 CTGGCTTCAATAATTTTAAATGG + Intronic
1000494632 5:161965989-161966011 TTCTCTAAAATATTCTTAAATGG - Intergenic
1000751695 5:165102970-165102992 AACACTACAATAATTATGAAGGG - Intergenic
1000797599 5:165684526-165684548 ATTTCTACATTGATGTTAAAGGG + Intergenic
1001868792 5:175132043-175132065 AAATCCACAGTAATTTTAAAAGG - Intergenic
1002017532 5:176336999-176337021 AACTGTACAAAAATTTTAACTGG + Intronic
1002624304 5:180514001-180514023 ATCTCTACAAAAAATAAAAATGG - Intronic
1003677647 6:8221479-8221501 ATCTCTACAAAAAAATTAAAAGG - Intergenic
1003730397 6:8816148-8816170 ATATCTATAATAAATATAAATGG + Intergenic
1003834332 6:10052681-10052703 ATTTTTACAAAAATTTTAAGAGG + Intronic
1004053878 6:12114670-12114692 ATCTTTGTAATTATTTTAAATGG + Intronic
1004651123 6:17609829-17609851 ATCACTATATTAATTTTCAAAGG + Exonic
1005216723 6:23537429-23537451 ATATTTACAATCATTTTAGAAGG + Intergenic
1005546168 6:26874664-26874686 GTCTCTATAATAAGTTTACAAGG + Intergenic
1005555498 6:26977222-26977244 ATCCATTGAATAATTTTAAAAGG - Intergenic
1005652852 6:27900414-27900436 ATCTCTTCAAATATTTTACAGGG + Intergenic
1006860408 6:37168895-37168917 AACTCTACATGAAGTTTAAAAGG + Intergenic
1007054147 6:38864972-38864994 ATTTCTGCAATAATTTAACAAGG + Intronic
1007159830 6:39780032-39780054 ATCTTTACACCAATTTTATAAGG + Intergenic
1007259871 6:40555992-40556014 ATCTCAACAATAATGATACAGGG + Intronic
1007320047 6:41021599-41021621 ATCCTCACAATAATCTTAAAAGG + Intergenic
1007458561 6:41999723-41999745 ATCTCTACAAAAAATTTAAAAGG + Intronic
1008189534 6:48438064-48438086 TTCTGCCCAATAATTTTAAAGGG + Intergenic
1008267121 6:49441581-49441603 ATCTATACTATCATTTTAATAGG - Intronic
1008322115 6:50127954-50127976 ATTTCTAAAATAACTTTAAAAGG - Intergenic
1008421651 6:51307743-51307765 ATTTTTATAATAACTTTAAAGGG + Intergenic
1008551911 6:52640746-52640768 ATCTTTACAACAATTTTGAGAGG + Intergenic
1009016878 6:57915454-57915476 GTCTCTATAATAAGTTTACAAGG + Intergenic
1009421488 6:63469419-63469441 ATCTTTACTTTAATTTTTAATGG - Intergenic
1009920911 6:70060324-70060346 ACCTCTACAATACTTATAGAAGG - Intronic
1010122061 6:72387736-72387758 ATCACTACAATGTTTCTAAAGGG + Intronic
1010474534 6:76270185-76270207 ATCTCTTCACTTATTTTCAAGGG + Intergenic
1010534389 6:77009699-77009721 AGCTTTACAATAATTTAAAAAGG - Intergenic
1010720254 6:79275487-79275509 TTCTCTACTATATTTTTTAAAGG - Intergenic
1011103795 6:83756492-83756514 ATCTTTACAACAATACTAAAAGG - Intergenic
1011610857 6:89148790-89148812 ATCTCTATCATCATTTTACAGGG - Intronic
1012031984 6:94082536-94082558 ATCTCTAAAATAATTTTACAAGG + Intergenic
1012185961 6:96217526-96217548 ATCTCAGCTATTATTTTAAAAGG + Intergenic
1012498403 6:99860886-99860908 ATCTTTAAAGTAATATTAAATGG + Intergenic
1012692879 6:102337136-102337158 ATCTAATCAATAATTTTAAATGG - Intergenic
1013012806 6:106135242-106135264 AACTCTACTTTCATTTTAAAAGG - Intergenic
1013154144 6:107477011-107477033 GTCTATAAAATAATTTTGAAAGG + Intergenic
1013420795 6:109964774-109964796 ATCTCTACAAAAAAATTAACTGG + Intergenic
1013999975 6:116354223-116354245 ATCTCCTTAAAAATTTTAAAGGG - Intronic
1014259179 6:119196725-119196747 AAGTCAACAAAAATTTTAAAAGG - Intronic
1014348662 6:120309973-120309995 ATCTGTACAATTTTTTTTAAAGG - Intergenic
1014779611 6:125548956-125548978 TTCTATATAATAATTTGAAAAGG - Intergenic
1014799560 6:125762936-125762958 TTCCCTAAAATAACTTTAAAGGG - Intergenic
1015006968 6:128295182-128295204 AACTTTAAAATAATTTTAACAGG + Intronic
1015073766 6:129129960-129129982 CTCAGTAAAATAATTTTAAAGGG + Intronic
1015344709 6:132142518-132142540 ATCTCTACAAGAATGTTATTTGG + Intergenic
1015413682 6:132923700-132923722 ATGTAATCAATAATTTTAAAAGG - Intergenic
1015850216 6:137564400-137564422 ATTTCTCAAATAATTTAAAATGG + Intergenic
1015956465 6:138603628-138603650 ATATCTACAATAATTTATAGTGG - Intronic
1016165488 6:140936943-140936965 AAATTTACAATATTTTTAAATGG + Intergenic
1016184954 6:141187333-141187355 ATCTTTTAAATATTTTTAAATGG - Intergenic
1016344270 6:143094775-143094797 TGTTCTACAATAATTTTCAATGG - Intronic
1016719022 6:147271422-147271444 ATCTCAATATTAATTTTAAAAGG + Intronic
1016729625 6:147414819-147414841 ATATTCATAATAATTTTAAAAGG + Intergenic
1017104629 6:150875831-150875853 ATGTTTACAATAATTTTCTAGGG - Intronic
1017188308 6:151624955-151624977 ATCTCCACAATAATTCTGATAGG + Intergenic
1017293078 6:152763912-152763934 ATTTCTAACATAATTTTAGAGGG - Intergenic
1017606465 6:156139768-156139790 ATCTCTACAAAAAATACAAAAGG - Intergenic
1018133899 6:160759577-160759599 ATAGCTACAATAATTTTTTAAGG + Intergenic
1018244810 6:161812767-161812789 ATCTCCACAATAATATTTAAGGG - Intronic
1018767052 6:166942609-166942631 ACCTCTACCAAAAATTTAAAAGG - Intronic
1020705225 7:11536027-11536049 ATCTTTTCAATAACTTAAAATGG - Intronic
1020966843 7:14880786-14880808 ATCTATACACTAAGTTTTAATGG - Intronic
1020993013 7:15225438-15225460 AATTATACTATAATTTTAAAGGG - Intronic
1021122959 7:16817563-16817585 ATCTGTACAGAATTTTTAAAGGG + Intronic
1021261594 7:18465061-18465083 AGCTCTACAAATATTTTTAAAGG - Intronic
1021271459 7:18592023-18592045 ATCTATATAGTAATTTCAAAAGG + Intronic
1021503920 7:21359875-21359897 ATCTAAAGGATAATTTTAAATGG + Intergenic
1021536436 7:21710127-21710149 TTTTCTACAACAATTTTCAAGGG - Intronic
1021570264 7:22057888-22057910 ATCTTTACAATTCTATTAAAAGG - Intergenic
1021712033 7:23425540-23425562 ATCTCTACAAAAAATTTAGCTGG - Intronic
1021926636 7:25540263-25540285 ATCTCTACAAAAAATTTAGTAGG + Intergenic
1022289858 7:28990435-28990457 ATCTGCTCAATCATTTTAAAGGG - Intergenic
1022569968 7:31442689-31442711 ATATCTACAAAAGCTTTAAAGGG - Intergenic
1022917946 7:34979831-34979853 ATCTCTAGATTAATTTAGAATGG - Intronic
1023080232 7:36519856-36519878 CTCTATACTATAATTTTAAATGG + Intronic
1023284793 7:38608005-38608027 ATCTCTACTAAAAATTGAAATGG - Intronic
1024028573 7:45435058-45435080 ATCTTCACAATAATTTTGCAAGG + Intergenic
1024175645 7:46837989-46838011 ATCTATATATTAATTTTATAAGG - Intergenic
1026407888 7:70086990-70087012 ATCTCTAGTATAATGTTGAATGG + Intronic
1026673201 7:72407278-72407300 CACTTTACAATAACTTTAAAAGG - Intronic
1027295549 7:76765696-76765718 ACCACTACAAGAACTTTAAAAGG + Intergenic
1027428201 7:78082913-78082935 TTCTGTATAATAATTTTAACTGG + Intronic
1027518599 7:79174309-79174331 ATTACTATAATAAATTTAAATGG + Intronic
1027875054 7:83758258-83758280 ATAAATACAAAAATTTTAAAGGG - Intergenic
1028134985 7:87215967-87215989 ATCTCTACAACAAATTAAAAAGG + Intronic
1028278702 7:88893404-88893426 ATTTTTAAAATAATTTTAAAGGG - Intronic
1029324941 7:99798366-99798388 AGCTCTACAATAATAGTAAGAGG + Intergenic
1029797029 7:102907268-102907290 ATCTAGAAAATAATTTCAAAAGG - Intronic
1029814715 7:103081310-103081332 ATCCCTAGAAAAATTTTAAATGG + Intronic
1029982569 7:104892905-104892927 AGCTATACAATCATTTTAAATGG + Intronic
1030278874 7:107749776-107749798 ATCAAAACAAAAATTTTAAAAGG - Intronic
1030537374 7:110785710-110785732 ATCTCTGCAATAAAATTAAGTGG - Intronic
1030877265 7:114830304-114830326 ACCTCTACAATAATTAAAAGAGG + Intergenic
1030879443 7:114858978-114859000 ATCTATTAGATAATTTTAAAAGG + Intergenic
1031092723 7:117379611-117379633 ACCTCTAAAATGATTTTTAAAGG + Intronic
1031247533 7:119335078-119335100 TCCTCAATAATAATTTTAAAAGG - Intergenic
1031257606 7:119475312-119475334 ATCTACAAAATCATTTTAAATGG - Intergenic
1031326186 7:120401445-120401467 ATTTGTACAGTATTTTTAAAAGG - Intronic
1031577422 7:123432016-123432038 TTCTCTAAAATAATTTATAAAGG - Intergenic
1031750259 7:125563107-125563129 TTATCTGCAATAATTTTAAGTGG - Intergenic
1031881102 7:127199490-127199512 ATCTCTGCAAAGATTTGAAAAGG - Intronic
1032908245 7:136398015-136398037 ATCTCTATAAAAATGTTGAATGG - Intergenic
1032983569 7:137312932-137312954 AACTGTAAAATAATTTTATATGG + Intronic
1032984221 7:137318982-137319004 ATCCCTACAGTAATTTAAAAAGG - Intronic
1033188061 7:139247933-139247955 ATGACTACAGTAATTATAAATGG - Intronic
1033307522 7:140235861-140235883 ATCTCTACTAAAAATATAAAAGG + Intergenic
1033728614 7:144148817-144148839 ATTACTACAATAATTTTTAAGGG + Intergenic
1033989171 7:147263176-147263198 ATCTCTACAAAAAGTGCAAAAGG + Intronic
1034855851 7:154546348-154546370 ATTTATTCAATAATTTTAATCGG + Intronic
1035490436 7:159271757-159271779 ATTTCTACAATAATATTCCAAGG + Intergenic
1035666331 8:1382877-1382899 ATCCCTTCCATAATTTTAATTGG - Intergenic
1036415931 8:8548632-8548654 TTCTGTAGAATAATTTTAAAGGG - Intergenic
1037795427 8:21989574-21989596 GTCACTTCAATAATTTTACAGGG - Intronic
1038030429 8:23634215-23634237 ATTTCTAGAATAGTTTTGAATGG - Intergenic
1038061769 8:23922087-23922109 ATCTCAAAAAAAATTTAAAAAGG - Intergenic
1038090175 8:24244112-24244134 ATCTTTAGAATAATTTAAAAGGG + Intergenic
1038840462 8:31180284-31180306 ATCTCTACAAAAATATTAGCTGG - Intergenic
1038907562 8:31923250-31923272 ACCTATACAATTATTTTAATAGG - Intronic
1039114878 8:34081779-34081801 ATCTAAAGAATAATTTTTAATGG - Intergenic
1039241822 8:35565652-35565674 ATGTCTACAATAATTTTTCTAGG + Intronic
1039856943 8:41423236-41423258 AACTGTACAATAATTTAAACAGG - Intergenic
1041243807 8:55872267-55872289 ATCTCTACAAAAAATACAAAAGG - Intergenic
1041322530 8:56628793-56628815 TTTTCCACAATAATTTTAGAAGG - Intergenic
1041379693 8:57241829-57241851 TTCACTAAAATCATTTTAAAAGG - Intergenic
1041806597 8:61856535-61856557 ATATTTAAAACAATTTTAAATGG + Intergenic
1042204503 8:66315031-66315053 TTCTCTGGAATAATTATAAATGG + Intergenic
1042298205 8:67244725-67244747 ATCTGGAAAATAGTTTTAAAAGG + Intronic
1042626485 8:70763673-70763695 ATATCTACTATAATATGAAAGGG - Intronic
1042794172 8:72642233-72642255 ATCTCATTAATAATTTTATATGG + Intronic
1042890405 8:73603693-73603715 ATCTTTTCAATAGTTTTAAAAGG + Intronic
1043087570 8:75854114-75854136 ATCTCATCAGTAATTTTAAAAGG + Intergenic
1043482485 8:80667296-80667318 AACTCTAACTTAATTTTAAAAGG + Intronic
1044467416 8:92524122-92524144 TTCTTTATAGTAATTTTAAAGGG - Intergenic
1044571656 8:93725320-93725342 ATACCTAAAATATTTTTAAAGGG - Intronic
1045229019 8:100282679-100282701 ATCTCTGCAAAATTTGTAAAAGG + Intronic
1045580259 8:103470848-103470870 TTCACAATAATAATTTTAAAAGG + Intergenic
1045731183 8:105243195-105243217 CTCTCTATAATTAATTTAAAGGG + Intronic
1045765595 8:105664063-105664085 ATATCCACAATTATCTTAAAAGG - Intronic
1046388328 8:113533456-113533478 CTCACTACAATAAATTTAAAAGG + Intergenic
1046530682 8:115441457-115441479 TTCTCTAGATTAAATTTAAATGG - Intronic
1046530994 8:115444709-115444731 AACTCAACAATTTTTTTAAATGG + Intronic
1047072411 8:121360469-121360491 ATCCTAGCAATAATTTTAAAGGG + Intergenic
1047270266 8:123351257-123351279 ATCTAAACAATAATTATCAATGG - Intronic
1047835481 8:128685531-128685553 GTCTCTACAAAAATTAAAAAGGG + Intergenic
1048488424 8:134869732-134869754 ATCTCTACAACAATTTTGTGAGG + Intergenic
1048503701 8:135001777-135001799 ATCTCTTCAAAAATTTTAAGTGG + Intergenic
1048649764 8:136462365-136462387 GTCTCAACATTAATTTTAGAAGG + Intergenic
1049131610 8:140849740-140849762 ATCTTTACAATAATTCTTCAAGG + Intronic
1050477328 9:6053624-6053646 ATCTCTCCAATAACTTGAACTGG - Intergenic
1050809181 9:9721687-9721709 ATCTCTTTAATAATTTTATCAGG - Intronic
1050842353 9:10168503-10168525 ATCTCTATAGAGATTTTAAAAGG - Intronic
1050944165 9:11497619-11497641 ATCTCTTCAAATATTTTACAGGG - Intergenic
1051157259 9:14163308-14163330 ATCACTACAATAAATGTATATGG + Intronic
1051194677 9:14550517-14550539 TTCTCAAAACTAATTTTAAATGG - Intergenic
1051407926 9:16758909-16758931 ATTTAAACAATATTTTTAAAAGG - Intronic
1051559803 9:18427823-18427845 ATCTCTACGTTCATTTTGAATGG - Intergenic
1051757586 9:20420921-20420943 ATCTATACAAACATTTTAAAAGG - Intronic
1051812366 9:21064390-21064412 CTCTCTAAAATAAATTTACAAGG + Intergenic
1052132430 9:24864836-24864858 AAAACTACAAAAATTTTAAAAGG - Intergenic
1052175733 9:25460606-25460628 ATTTCTATAAAAATTTTATAAGG + Intergenic
1052207465 9:25860510-25860532 ATTTCTACATTAATACTAAAAGG + Intergenic
1052465789 9:28828336-28828358 ATATCTAAAATATTTTGAAATGG - Intergenic
1052612363 9:30791231-30791253 ATCTCTACCATACTTATAACAGG - Intergenic
1053111430 9:35463540-35463562 ATCTCTATAAGAATTTTAAAGGG - Intergenic
1053261074 9:36664907-36664929 AGCTCAACCATAAATTTAAAAGG + Intronic
1053557929 9:39157669-39157691 GTCTCCAACATAATTTTAAAAGG + Intronic
1053729259 9:41035910-41035932 ATCTTTGCAATAATTTTATGAGG - Intergenic
1053822048 9:41977954-41977976 GTCTCCAACATAATTTTAAAAGG + Intronic
1054139185 9:61461283-61461305 GTCTCCAACATAATTTTAAAAGG - Intergenic
1054608526 9:67209460-67209482 GTCTCCAACATAATTTTAAAAGG - Intergenic
1054699253 9:68396156-68396178 ATCTTTGCAATAATTTTATGAGG + Intronic
1054934473 9:70672039-70672061 ATCTCTACAATTATATTAAAAGG - Intronic
1055158471 9:73095056-73095078 ATCTCAACATGAATTTTAGAGGG + Intergenic
1055676290 9:78665064-78665086 ATCTCCACAGTAATCTTATAAGG + Intergenic
1055846327 9:80567946-80567968 ATCACAACATAAATTTTAAAAGG - Intergenic
1056009021 9:82305726-82305748 ATCTAAATAATAATTTCAAATGG + Intergenic
1056275506 9:84990929-84990951 TCCTCTTCAATAATTTTAAAAGG - Intronic
1056335279 9:85562519-85562541 ATCTATAAAATTATTTTAATTGG - Intronic
1056421086 9:86426883-86426905 AACTGTACAATAAATTTAAAAGG - Intergenic
1056431224 9:86529842-86529864 ATCTCTACCTTAATTTGAACAGG - Intergenic
1057362491 9:94387100-94387122 TTCTCCACAAAAATATTAAAAGG - Intronic
1057366528 9:94427224-94427246 AAGTCAATAATAATTTTAAAAGG - Intronic
1057524334 9:95785470-95785492 AACTCTGGTATAATTTTAAAAGG + Intergenic
1057613537 9:96567627-96567649 ATCTCTACAATAATTTTAAATGG - Intronic
1057660846 9:97000995-97001017 TTCTCCACAAAAATATTAAAAGG + Intronic
1057778622 9:98031563-98031585 ATAGCTAGAATAATTTTAGATGG + Intergenic
1058291645 9:103249275-103249297 ATGACAAAAATAATTTTAAAAGG + Intergenic
1059357504 9:113711351-113711373 AACTTTACAACAATTTTACAAGG - Intergenic
1059894508 9:118846571-118846593 ATCTCTAAAATAATTATAGCTGG + Intergenic
1059946889 9:119418372-119418394 TTTTCTACATTGATTTTAAAGGG + Intergenic
1059988126 9:119839487-119839509 ATCCTCACAACAATTTTAAATGG - Intergenic
1060121976 9:121000266-121000288 AACCCTATTATAATTTTAAAAGG + Intronic
1061904896 9:133691617-133691639 ATCTCAAAAGTAATTTTAAATGG - Intronic
1203431957 Un_GL000195v1:99460-99482 ATTTCTACAAGAATGTAAAAAGG + Intergenic
1203434536 Un_GL000195v1:125125-125147 ATTTCTACAAGAATGTAAAAAGG - Intergenic
1203654848 Un_KI270752v1:13837-13859 ATCCCTACAATCATTTTGATTGG + Intergenic
1186600046 X:11027080-11027102 ATTTCTAGACTATTTTTAAAAGG + Intergenic
1186661161 X:11668441-11668463 ATGTCTACAATAATTATCATTGG - Intergenic
1186772503 X:12831613-12831635 GTCTCTACAAAAATATTTAAAGG - Intergenic
1187211643 X:17238030-17238052 AACTCAACAATGTTTTTAAAGGG - Intergenic
1187558504 X:20376441-20376463 ATTTTTACAAAGATTTTAAATGG + Intergenic
1187587987 X:20685136-20685158 ATCTCCACGCAAATTTTAAAGGG - Intergenic
1187668161 X:21639043-21639065 GTCTGTATAATAATTTTAACTGG + Intronic
1187752387 X:22481421-22481443 ATTTCTCAAAAAATTTTAAATGG - Intergenic
1187793775 X:22979362-22979384 ATCTCTTCAGTTATTTTAACAGG - Intergenic
1188217053 X:27491531-27491553 ATGGCTAAAATAATTTTAAAAGG - Intergenic
1188343529 X:29035263-29035285 AAATCTCCAATAATTTTTAAAGG + Intronic
1188412753 X:29894735-29894757 ATCTACAAATTAATTTTAAATGG + Intronic
1188499885 X:30813649-30813671 GAATCTACAATTATTTTAAAAGG - Intergenic
1188535154 X:31188937-31188959 ATCAATATAATAAGTTTAAAAGG + Intronic
1189000883 X:36944145-36944167 ATCTCTACAATATTTTTTGTAGG + Intergenic
1189162781 X:38827547-38827569 ATCTCTACAAAAAATTAAAAAGG + Intergenic
1189637746 X:43029846-43029868 TTCTGTAAAATAATTTTTAAAGG - Intergenic
1189644161 X:43108558-43108580 ATTTTTACAATAATTTTATATGG + Intergenic
1189983853 X:46536289-46536311 ATCTCTACAAAAATAAAAAAGGG + Intronic
1190749312 X:53347079-53347101 ATCCCTACAATAATTCTAGGAGG - Intergenic
1190782836 X:53615032-53615054 ATTTCAACAACAATTCTAAAAGG + Intronic
1190866916 X:54392492-54392514 ATCTCTACAAAAAAATAAAAAGG - Intergenic
1191202394 X:57797776-57797798 ATCACTATAAAAATTTCAAAAGG - Intergenic
1191635852 X:63375675-63375697 ATAGCTAGAATAATTTTAAAAGG + Intergenic
1191764353 X:64681154-64681176 ATCTGGACAATCAATTTAAATGG - Intergenic
1192355763 X:70401775-70401797 ATGTCTTCAATAATTTTTAAGGG + Intronic
1192366520 X:70478267-70478289 AGCTGTACAATTATTATAAAAGG - Intronic
1193131184 X:77921400-77921422 ATATATGCCATAATTTTAAAAGG - Intronic
1193177924 X:78416575-78416597 CTTTCTCCAATAATTGTAAAGGG - Intergenic
1193283867 X:79688786-79688808 ATCTCTTCAAATATTTTACAGGG - Intergenic
1193951471 X:87805940-87805962 CTCTCTAAAATATTTTTAAAAGG + Intergenic
1194154704 X:90372913-90372935 ATCTTTAAAATAATTTTAGATGG + Intergenic
1194299561 X:92168700-92168722 ATATCTAAAATAACTTTCAATGG - Intronic
1194383643 X:93225297-93225319 GTCCCTAAAATAATTTTAGAAGG + Intergenic
1194548207 X:95264498-95264520 AGCTCTATAATAATTTGAATGGG - Intergenic
1194548334 X:95266687-95266709 ATTTCTCCAATAATTTTAATAGG + Intergenic
1194898776 X:99480527-99480549 ATGTCTAAAATTATTTCAAATGG - Intergenic
1195096870 X:101510755-101510777 ATCTTTACTGTAATTTTAATGGG + Intronic
1195272995 X:103251502-103251524 ATCTATACATAAAATTTAAAAGG - Intergenic
1195603293 X:106772831-106772853 ATTGCTAAAATGATTTTAAATGG - Intronic
1196082404 X:111647559-111647581 CCCTCTAAAATAATTATAAAAGG + Intergenic
1196607633 X:117674105-117674127 ATCTAGATAAGAATTTTAAAAGG + Intergenic
1196694158 X:118593361-118593383 CTCTCTACAGTTATTTGAAATGG + Intronic
1196756092 X:119158566-119158588 ATAACTACATTAATTTAAAAAGG - Intergenic
1197157942 X:123290814-123290836 ATCCCTACAATAATTCCAAATGG + Intronic
1197291613 X:124665516-124665538 TTCTCTGCAAGTATTTTAAATGG + Intronic
1197984705 X:132255360-132255382 AAATCTACAATTTTTTTAAAAGG + Intergenic
1198052962 X:132966492-132966514 ATCTTTACAATAATTCTGCAAGG + Intergenic
1198123690 X:133621050-133621072 ATCTCTTCAAATATTTTACAGGG + Intronic
1198431273 X:136568650-136568672 ATCTCTAGCATCATTTTTAATGG - Intergenic
1198665926 X:139022735-139022757 GCCTCTGCAATCATTTTAAAAGG + Intronic
1198697760 X:139361833-139361855 ATCTCAAGAAGAATTTTAATTGG + Intergenic
1198880602 X:141276977-141276999 ATCTCAGCAATAATTTTTGAGGG - Intergenic
1199195550 X:145025662-145025684 ATCTCTATAATCACTTGAAAAGG + Intergenic
1199240019 X:145536054-145536076 ATATTTAGAATACTTTTAAAAGG - Intergenic
1199266481 X:145833372-145833394 ATCTTAAAAATAAATTTAAAAGG + Intergenic
1200293409 X:154893344-154893366 ATCTCTTCAAGTATTTTACAGGG + Intronic
1200314148 X:155114003-155114025 ATCTCAACAATAATGTACAAGGG - Intronic
1200501057 Y:3949803-3949825 ATCTTTAAAATAATTTTAGATGG + Intergenic
1200558531 Y:4669471-4669493 ATCTCCACAATAAATCTCAAGGG + Intergenic
1201433840 Y:13934267-13934289 ATCTCTTCAAATATTTTACAGGG + Intergenic
1201456719 Y:14176081-14176103 ATCTGAATAATTATTTTAAAAGG - Intergenic
1202111424 Y:21425665-21425687 TTATTTAAAATAATTTTAAAAGG + Intergenic