ID: 1057613538

View in Genome Browser
Species Human (GRCh38)
Location 9:96567640-96567662
Sequence TTGTAGAGATAGAGAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057613537_1057613538 -10 Left 1057613537 9:96567627-96567649 CCATTTAAAATTATTGTAGAGAT 0: 1
1: 0
2: 13
3: 104
4: 761
Right 1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG No data
1057613536_1057613538 3 Left 1057613536 9:96567614-96567636 CCTTTTTAAACAACCATTTAAAA 0: 1
1: 1
2: 14
3: 102
4: 968
Right 1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG No data
1057613535_1057613538 4 Left 1057613535 9:96567613-96567635 CCCTTTTTAAACAACCATTTAAA 0: 1
1: 1
2: 6
3: 108
4: 968
Right 1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057613538 Original CRISPR TTGTAGAGATAGAGAGTAGA AGG Intronic
No off target data available for this crispr