ID: 1057616625

View in Genome Browser
Species Human (GRCh38)
Location 9:96596743-96596765
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1199
Summary {0: 16, 1: 30, 2: 124, 3: 296, 4: 733}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057616625_1057616635 17 Left 1057616625 9:96596743-96596765 CCCAGCTACAGGAGGCTGAGGTG 0: 16
1: 30
2: 124
3: 296
4: 733
Right 1057616635 9:96596783-96596805 CAGGAGGTCAAGGCTGCAGTGGG 0: 93
1: 289
2: 600
3: 1310
4: 2979
1057616625_1057616631 1 Left 1057616625 9:96596743-96596765 CCCAGCTACAGGAGGCTGAGGTG 0: 16
1: 30
2: 124
3: 296
4: 733
Right 1057616631 9:96596767-96596789 GCGGATCACTTGAATCCAGGAGG No data
1057616625_1057616634 16 Left 1057616625 9:96596743-96596765 CCCAGCTACAGGAGGCTGAGGTG 0: 16
1: 30
2: 124
3: 296
4: 733
Right 1057616634 9:96596782-96596804 CCAGGAGGTCAAGGCTGCAGTGG 0: 89
1: 303
2: 615
3: 1403
4: 3093
1057616625_1057616632 7 Left 1057616625 9:96596743-96596765 CCCAGCTACAGGAGGCTGAGGTG 0: 16
1: 30
2: 124
3: 296
4: 733
Right 1057616632 9:96596773-96596795 CACTTGAATCCAGGAGGTCAAGG 0: 6
1: 302
2: 3307
3: 19589
4: 64165
1057616625_1057616630 -2 Left 1057616625 9:96596743-96596765 CCCAGCTACAGGAGGCTGAGGTG 0: 16
1: 30
2: 124
3: 296
4: 733
Right 1057616630 9:96596764-96596786 TGGGCGGATCACTTGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057616625 Original CRISPR CACCTCAGCCTCCTGTAGCT GGG (reversed) Intronic
900686404 1:3950954-3950976 CTGCTCAGCCTCTTGTAGCTGGG - Intergenic
900890099 1:5443413-5443435 CTCCTCAGCCTCCGGAAGCATGG + Intergenic
900952407 1:5865397-5865419 CAGCTCTGCCTCCTGTGGCCTGG - Intronic
901009795 1:6193697-6193719 CACCTCAGCCTCCCAAAGCGTGG + Intronic
901138623 1:7013628-7013650 CACCTCTGCCACCTGCAGCCAGG - Intronic
901230549 1:7639655-7639677 CACTTCAGCCTCCTGAGGCTGGG - Intronic
901249060 1:7759033-7759055 CACCTCAGCCTCCAGTAGCTGGG - Intronic
901399781 1:9007848-9007870 TGCCTCCGCCTCCTGTAGCTGGG + Intronic
901480614 1:9522419-9522441 TGCCTCAGCCTCGAGTAGCTGGG - Intergenic
901503230 1:9666977-9666999 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
901579031 1:10225233-10225255 AGCCTCAGCCTCAAGTAGCTGGG - Intronic
901793476 1:11666896-11666918 CGCCTCAGCCTCCTGAAGTCTGG - Intronic
901906438 1:12416067-12416089 TACCTCAGCCTCCCGTAGCTGGG - Intronic
901910095 1:12450007-12450029 TGCCTCAGCCTCCCGTAGCAGGG - Intronic
902502625 1:16921254-16921276 CACCCCAGCCCCCACTAGCTGGG - Intronic
902546841 1:17195545-17195567 AACCTCAGGCTCCTGCACCTGGG + Intergenic
902558932 1:17264893-17264915 CACTTCAGCCTCCTGAGGCTGGG - Intronic
902710595 1:18236920-18236942 CCCCTCAGCCCACTCTAGCTAGG - Intronic
902946038 1:19839910-19839932 CACCTTAGCCTCGAGTAGCTGGG - Intergenic
902985813 1:20153408-20153430 CACCCCTGTCTCCTGTTGCTAGG - Intergenic
903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG + Intronic
903422848 1:23231134-23231156 CCCCTCAGCCTCCTCCAGATTGG + Intergenic
903477677 1:23631048-23631070 CACCTCAGCCTCCTGAGTCTGGG - Intronic
903790732 1:25891215-25891237 TGCCTTAGCCTCCTGCAGCTGGG - Intronic
903806825 1:26011613-26011635 CACCTCAGCCTCAAGCAGCTGGG + Intergenic
903909368 1:26711220-26711242 TGCCTCAGCCTCTCGTAGCTGGG + Intronic
903941467 1:26934771-26934793 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
904032830 1:27543827-27543849 TGCCTCAGCTTCCTGTAGCTGGG - Intronic
904306645 1:29594251-29594273 CACCATGGCCTCCTTTAGCTAGG - Intergenic
904766581 1:32853356-32853378 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
904854316 1:33485521-33485543 TGCCTCAGCCCCCTGTAGCTGGG + Intronic
905123190 1:35698218-35698240 CACCTCAGCCTCCCAAAGTTAGG + Intergenic
905147232 1:35896474-35896496 TGCCTCAGCCTCCAGTAGCTAGG + Intronic
905187292 1:36205600-36205622 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
905228667 1:36497006-36497028 TACCTCAGCCTGTAGTAGCTGGG + Intergenic
905403268 1:37717836-37717858 CACCTCAGCTCCCTGTGCCTTGG - Exonic
905633886 1:39536067-39536089 TGCCTCAGCCTCCCCTAGCTAGG - Intergenic
906158373 1:43628009-43628031 ATTCTCAGCCTCATGTAGCTGGG + Intergenic
906261486 1:44394871-44394893 CACCTCAGCCTCCCAAAGTTGGG - Intergenic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906405840 1:45541236-45541258 CACCTCAGCCTCCTGACTATAGG - Intergenic
906413672 1:45601866-45601888 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
906467750 1:46098948-46098970 CACCTCAGTCTCCCAGAGCTGGG + Intronic
906498047 1:46319604-46319626 TACCTCAGCTTCCCATAGCTAGG + Intergenic
906768145 1:48455494-48455516 TACCTCAGCCTCAAGTAGCTGGG + Intronic
906888659 1:49682288-49682310 TGCCTCAGCCTCCTGTACCTGGG - Intronic
906970067 1:50503503-50503525 CTCCTCAGGCTCCTATAGCTGGG - Intronic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
907010902 1:50961779-50961801 CACCTCAGCCTCCTGAGAGTGGG + Intronic
907041542 1:51265208-51265230 CACCTCAACCTCGAGTAGCTGGG - Intronic
907054613 1:51353688-51353710 CACCTCAGCCCCCAGTAGCTGGG + Intergenic
907117280 1:51979925-51979947 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
907143583 1:52211589-52211611 GGCCTCAGCCTCCTGAGGCTGGG - Intronic
907177488 1:52538531-52538553 CACTTCAGCCTCCTGAGACTGGG - Intronic
907279716 1:53339640-53339662 CACCTCAGCCTCCCAAGGCTAGG + Intergenic
907358528 1:53895936-53895958 CACCTCAGCTTCCTACAGCTAGG + Intronic
907409882 1:54276360-54276382 CACCTCAGCCTCCTCAGGCTGGG - Intronic
907839980 1:58147500-58147522 TGCCTCAGCCTCGAGTAGCTGGG - Intronic
907885132 1:58585871-58585893 CACCTCAGCTTCAAGTAGCTAGG + Intergenic
908017457 1:59858621-59858643 CGCCTCAGCCTCCCAGAGCTAGG - Intronic
908375976 1:63541676-63541698 TACCTCAGCCTCCTGAGGCTGGG + Intronic
909610829 1:77550189-77550211 TACCTCAGCCTCCTAAAGCATGG + Intronic
909623537 1:77690999-77691021 TGCCTCAGCCTCCCATAGCTGGG - Intergenic
909646496 1:77922709-77922731 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
909658173 1:78053814-78053836 CACCTCAGCCTCCTGAATACTGG - Intronic
911038134 1:93571382-93571404 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
911137734 1:94459158-94459180 TACCTCAGCCTGAAGTAGCTGGG + Intronic
911199286 1:95028319-95028341 CACCTCAGCCTCCAGTAGCTGGG + Intronic
911370376 1:96988551-96988573 TGCCTCAGCCTAATGTAGCTGGG + Intergenic
911704760 1:100998393-100998415 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
912355953 1:109054231-109054253 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
912761609 1:112372323-112372345 CACCTCAGCCTCCTAAAGTGTGG - Intergenic
912761876 1:112374922-112374944 CACCTCATCCCCAAGTAGCTGGG - Intergenic
913283225 1:117205268-117205290 CACCTCAGTCCCGAGTAGCTGGG + Intronic
913377811 1:118173744-118173766 CAAGTCAGCCTCAAGTAGCTGGG - Intronic
913523182 1:119665672-119665694 CACCTGAGCCTCTTGTATCCAGG - Intronic
914245287 1:145881169-145881191 TGCCTCAGTCTCCTGTAGCTGGG - Intronic
914789941 1:150868782-150868804 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
915163757 1:153936915-153936937 CACCTCAGTCTCAAGTAGCTGGG + Intronic
916093075 1:161324217-161324239 AGCCTCAGCTTCCTGTAGCTGGG + Intronic
916201053 1:162272098-162272120 CACCTCAACCTCCTGAAGTGTGG + Intronic
916532507 1:165670955-165670977 CACCTTAGCCTCCTATAGCTGGG - Intronic
917103345 1:171467813-171467835 CACCTCAGCCACAGATAGCTGGG + Intergenic
917157257 1:172016971-172016993 CACCTCAGCCTCCTGGGAATTGG + Intronic
917204959 1:172562445-172562467 TGCCTCAGCCTCCCATAGCTGGG + Intronic
917213100 1:172650028-172650050 CCCTTCAACCTCCTGTAACTTGG + Intergenic
917286495 1:173426706-173426728 CACCTCGGCCCCGAGTAGCTGGG + Intergenic
917329085 1:173863136-173863158 CTCTTCAGCCTCTTGTAGCTAGG - Intergenic
917386049 1:174475655-174475677 CACCTCAGCCTCCCAGAGCTGGG - Intronic
918060020 1:181052949-181052971 TGCCTCAGCCTCCAGGAGCTGGG - Intronic
918068276 1:181116663-181116685 CACCTCAGCCCCCTATAGCTGGG + Intergenic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
918991477 1:191702042-191702064 TGCCTCAGCCACCTGAAGCTGGG - Intergenic
919332208 1:196186550-196186572 TGCCTCAGCCTCCAATAGCTGGG + Intergenic
919583275 1:199404359-199404381 CACATCATCCTCCTCCAGCTAGG - Intergenic
919706420 1:200680622-200680644 CACCTCAGCCCCACGTAGCTGGG - Intergenic
919729633 1:200904844-200904866 TTCCTCAGCCTCTAGTAGCTGGG + Intronic
920086855 1:203423738-203423760 CACCTCAGCCTCCCATAGGTGGG - Intergenic
920131349 1:203734456-203734478 CACCTCGGCCTCCTAAAGTTGGG - Intronic
920146359 1:203864527-203864549 CACCTCAGCCTCTAGTAGCTGGG + Intronic
920411615 1:205765950-205765972 CACCTCAGCCTCGAGTAGCTGGG - Intergenic
920422828 1:205847129-205847151 CACCTCAGCCTCCTGTAACTAGG + Intronic
920423628 1:205854608-205854630 CACCTCAGCCTCCTGTAACTAGG - Intergenic
921003712 1:211070706-211070728 TGTCTCAGCCTCCTGTAGCTGGG - Intronic
921082950 1:211758059-211758081 CTCCTCACCCTGCTGTATCTTGG + Intronic
921726796 1:218533245-218533267 CACCTCAGCCTCCCAGTGCTGGG + Intergenic
922000447 1:221472601-221472623 TACCTCAGCCCCGAGTAGCTGGG + Intergenic
922222842 1:223621603-223621625 CACATGAGCCTCCTGTAGGAAGG - Intronic
922289355 1:224197815-224197837 CATTTCAGCCTCGAGTAGCTGGG + Intergenic
922367448 1:224879069-224879091 CCACTCAGCCTCCAGTAGCTGGG - Intergenic
922416965 1:225431026-225431048 CACCTCAGCCCCGAGTAGCTGGG + Intergenic
922707476 1:227796900-227796922 CACCTCACCCTCCTGGGGTTGGG + Intergenic
922912396 1:229228592-229228614 CCCCTCAGTCTCCTGAAGCTGGG - Intergenic
923306480 1:232693528-232693550 CTCCTCAGCCTTCTTTAGCCAGG - Intergenic
923711424 1:236390437-236390459 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
923727669 1:236521577-236521599 CGCCTCGGCCTCCTGTAACCTGG - Intronic
923756123 1:236792729-236792751 CACCTCTGCCTCCAGTAGCTGGG + Intergenic
924060528 1:240169578-240169600 CGCCTCAGCCTCAAGTAGCTGGG + Intronic
924329122 1:242924807-242924829 CACCTCCGCCTCCTGGAGTCTGG + Intergenic
924489885 1:244526157-244526179 CACCTCAGCCTCCCAATGCTGGG - Intronic
924621029 1:245660927-245660949 TGCCTCAACCTCCTGTAGCTGGG + Intronic
924705340 1:246496710-246496732 TACCTCAGCCTTGAGTAGCTGGG - Intronic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
1063126361 10:3139774-3139796 CGCCTTAGCCTCCTGTAGCTAGG + Intronic
1063410847 10:5835498-5835520 TGCCTCAGACTCCTATAGCTGGG + Intronic
1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG + Intergenic
1064112971 10:12554269-12554291 CGCCTCAGCCTCCCGAAGCTGGG + Intronic
1064178259 10:13094370-13094392 TACCTCAGCCTCTAGTAGCTGGG + Intronic
1064202499 10:13296709-13296731 CACCTCAGCCTCCCAAAGCTAGG - Intronic
1064624442 10:17247977-17247999 CACCTCAGCCTCCCAAAGTTTGG - Intergenic
1064834878 10:19515303-19515325 CACACCAGCTTCCTGTAGATTGG + Intronic
1064842933 10:19615400-19615422 CACCTCAGCCTTGAATAGCTGGG - Intronic
1065514119 10:26507381-26507403 CGCCTCAGCCACCTGTAGCTGGG - Intronic
1065952503 10:30664922-30664944 TGTCTCAGCCTCCCGTAGCTGGG - Intergenic
1066109727 10:32185213-32185235 CCTGTCAGCCTCCTGTACCTAGG - Intergenic
1066127656 10:32357572-32357594 TGCCTCAGCCTTCAGTAGCTGGG + Intronic
1066363796 10:34756567-34756589 TGCCTCAGCCTCAAGTAGCTGGG + Intronic
1066705273 10:38170969-38170991 CACCCCTGCCTGCTTTAGCTAGG - Intergenic
1067076003 10:43182759-43182781 CATCTCAGCCCCGAGTAGCTGGG - Intronic
1067407349 10:46034888-46034910 CACCTCAGCCCCAAGTAGCTGGG - Intronic
1067676120 10:48378876-48378898 CACCTCAGCCGTGAGTAGCTGGG + Intronic
1068080272 10:52310743-52310765 CACCTCACCCCCAAGTAGCTGGG - Intergenic
1068577729 10:58703276-58703298 CACCACAGACTCAAGTAGCTGGG + Intronic
1069108563 10:64414132-64414154 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1069490340 10:68855550-68855572 CGCCTCAGCCTCACATAGCTGGG + Intronic
1069742920 10:70696932-70696954 CACCCCAGCATCCAGTTGCTGGG + Intronic
1069865587 10:71500981-71501003 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1070122603 10:73593261-73593283 CACCTCAGCCTGGAGTAACTGGG - Intronic
1070291667 10:75120383-75120405 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1070350824 10:75590859-75590881 TGCCTCAGCCTCCTGCAGCTGGG + Intronic
1070513739 10:77184466-77184488 CGCCTCAGCCTCCCAAAGCTGGG + Intronic
1070553360 10:77509232-77509254 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1070621638 10:78016759-78016781 CACCTCAGCCTACCGTAGCTAGG - Intronic
1071194782 10:83145221-83145243 TGCCTCAGCCTTCAGTAGCTGGG - Intergenic
1071285864 10:84144467-84144489 TGCCTCAGGCTCCTGTAGGTGGG + Intronic
1071589929 10:86863091-86863113 TACCTCGGCCTCAAGTAGCTGGG + Intronic
1071698728 10:87905589-87905611 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1072548260 10:96457183-96457205 GGCCTCAACCTCCTGTATCTTGG + Intronic
1072593201 10:96846366-96846388 CACCTGAGCCTCCTGAGGCTGGG + Intronic
1072593624 10:96850598-96850620 CACCTCAGCCTCCTGAGTATGGG + Intronic
1073129146 10:101175465-101175487 CACCTCAGCCCCAGGTGGCTAGG + Intergenic
1073158865 10:101372368-101372390 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
1073181417 10:101585714-101585736 CACCTAAACCTCTTATAGCTGGG + Intronic
1073198727 10:101717303-101717325 CACCACAGCCTCCTGTAGCTGGG + Intergenic
1073246718 10:102095956-102095978 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1073361487 10:102902975-102902997 TGCCTCAGCCTCGAGTAGCTGGG - Intergenic
1073400954 10:103257306-103257328 CACCTCAGCCTCCACTTCCTGGG + Intergenic
1073431279 10:103489043-103489065 CACCTCAATCTCGAGTAGCTGGG - Intergenic
1073567797 10:104550217-104550239 CACCTCAGCCTCCCAGTGCTAGG + Intergenic
1074950694 10:118332056-118332078 TACCTCAGCTTCCTGTAGCTGGG - Intronic
1075093937 10:119458863-119458885 CACCGCAGCCTCCTTGAGCCTGG + Intronic
1075145526 10:119879706-119879728 CACCTCATCCCCAAGTAGCTGGG - Intronic
1075152136 10:119943474-119943496 TGCCTCAGCCTCCTGTAGCTGGG - Exonic
1075396291 10:122130109-122130131 TGCCTCAGCCTCGTGTGGCTGGG + Intronic
1075773190 10:124958301-124958323 CACCTCAGCCTCACATACCTGGG - Intronic
1077011875 11:382440-382462 CACCCCAGCCTCCTCTAGGGTGG + Intergenic
1077057601 11:602564-602586 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
1077155512 11:1089226-1089248 CTCCCCAGCTGCCTGTAGCTGGG - Intergenic
1077674464 11:4184104-4184126 CAGCTCAGGCTGCTGTAACTGGG - Intergenic
1078169909 11:8921756-8921778 CACTACAGCCCCCAGTAGCTGGG + Intronic
1078275380 11:9839984-9840006 CACCTCAGCCTCCCAGTGCTGGG - Intronic
1079036935 11:17028067-17028089 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1079203796 11:18396374-18396396 CACCGCAGGCTCCTGTGCCTTGG + Exonic
1079410886 11:20186460-20186482 CACCTTGGCCTCCTTTGGCTGGG - Intergenic
1080307604 11:30853636-30853658 CCCCTCACCCTCCTGTAGCTTGG - Intronic
1080511788 11:32982004-32982026 CACCTCAGACTCAAGTAGCTGGG + Intronic
1080650550 11:34219427-34219449 CTCCTCAGCCTCCCACAGCTGGG - Intronic
1081328785 11:41778874-41778896 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1081777133 11:45683317-45683339 CACCTCTGCATCCTGTAGGAAGG - Intergenic
1081898445 11:46607147-46607169 TACCTCAGCCTCCTGTAGCTGGG - Intronic
1081926981 11:46838678-46838700 CACCTCAGCCTCTAGTGGCTGGG - Intronic
1082014271 11:47472666-47472688 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1082125089 11:48423002-48423024 CACCTCAGCCTCCCAAAGCGTGG + Intergenic
1083283091 11:61639489-61639511 CGCCTCAGCCTCCTATAGGTGGG - Intergenic
1083734916 11:64674511-64674533 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1083974756 11:66108853-66108875 TACCTCAGCCCCAAGTAGCTAGG - Intronic
1084674592 11:70626789-70626811 CAGCTCTGCCTCCTGTGGGTGGG - Intronic
1084897673 11:72286341-72286363 CACCTCAGCCTCGAGTAGCTGGG + Intergenic
1084975833 11:72797553-72797575 TGCCTCAGCCTCGAGTAGCTGGG - Intergenic
1085382878 11:76136611-76136633 CACCTCAGCCCACAGTTGCTGGG + Intronic
1085950410 11:81324307-81324329 CACCGCAACCTCCTCTTGCTGGG + Intergenic
1085964495 11:81504623-81504645 CACCTCAGCCTCCTGAACAGTGG - Intergenic
1086092316 11:83017221-83017243 CACTTCACCCTCTAGTAGCTGGG - Intronic
1086103455 11:83125809-83125831 CACCTCAGCCTCCTGAGTATTGG + Intergenic
1086167644 11:83798032-83798054 AACCTCAGAGTCCTGTAGCCAGG - Intronic
1087947049 11:104175492-104175514 CACCTCGGCCTCCCAAAGCTGGG - Intergenic
1088167704 11:106957505-106957527 CACCACCGCCTCCTTTGGCTTGG + Intronic
1088238152 11:107747211-107747233 CTCCTCAGCCTTGAGTAGCTGGG - Intergenic
1088872331 11:113901325-113901347 CATCCCAGCCTCCCATAGCTGGG - Intergenic
1088985309 11:114900248-114900270 CCTCTCAGCCACCTGGAGCTGGG - Intergenic
1089092433 11:115889034-115889056 AACCTCAGCCTCCTGTCTGTGGG - Intergenic
1089408198 11:118216253-118216275 TGTCTCAGCCTCCCGTAGCTGGG - Intronic
1089454877 11:118620376-118620398 TGCCTCAGCCTCCCATAGCTGGG - Intronic
1089530809 11:119127967-119127989 TGCCTCAGCCTCTTGTAGCTGGG + Intronic
1089544526 11:119212889-119212911 AACCTCTGCCTCCTGTAGCCAGG - Intronic
1090929556 11:131283348-131283370 CACCTCAGCCCCCAGTAGCCTGG - Intergenic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1091569018 12:1668421-1668443 CATCTCAGCCTCCCAAAGCTTGG + Intergenic
1091751624 12:3025190-3025212 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1092349276 12:7742395-7742417 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1092376416 12:7959379-7959401 CATCTCAGCCTCCTAAAGCAAGG - Intergenic
1092393249 12:8100524-8100546 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
1092396374 12:8130628-8130650 CACCTCAGCCTCCCCGTGCTGGG + Intronic
1092656919 12:10695514-10695536 TGCCTCAGCCTCCCATAGCTGGG - Intergenic
1093453931 12:19345647-19345669 TGCCTCAGCCTCTCGTAGCTGGG - Intronic
1093475004 12:19544992-19545014 CACCTCAGCCTCCTGAATAGCGG + Intronic
1093533144 12:20191016-20191038 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
1093564190 12:20582304-20582326 CACCTCAGACCCAAGTAGCTGGG + Intronic
1093810974 12:23491673-23491695 CACCTCACCCTCCAGTAGCTGGG + Intergenic
1094000501 12:25689011-25689033 TGCCTCAGCCCCCAGTAGCTGGG - Intergenic
1094035677 12:26067877-26067899 TACCTCAGCCTCCTGTAGCCGGG + Intronic
1094138257 12:27152119-27152141 CACCTCAGCCTCCTATATTCGGG + Intergenic
1095053286 12:37573213-37573235 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1095208311 12:39463543-39463565 AACCTCAGCCTCCAGTAACTAGG + Intergenic
1095663491 12:44766002-44766024 AGCCTCCACCTCCTGTAGCTGGG - Intronic
1096169368 12:49454764-49454786 CACCTCAGCCTCCTGAGTCACGG - Intronic
1096287226 12:50310869-50310891 CACCTCAGCCTCTCGATGCTGGG - Intergenic
1096453086 12:51761601-51761623 CACCTCAGCCTCCTGGTCCCTGG + Intronic
1096545282 12:52334770-52334792 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1096805702 12:54139920-54139942 TGCCTCAGCCTCCCGTAGCTAGG - Intergenic
1096831784 12:54320444-54320466 TGCCTCAGCCTCCCATAGCTGGG + Intronic
1097810366 12:64012664-64012686 CACCTCAGCCTCTCATAGCTGGG + Intronic
1097947965 12:65393515-65393537 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
1098009434 12:66034577-66034599 CACCTCAGCCTCAAGTAGCAGGG + Intergenic
1098301625 12:69060167-69060189 CACCTCAGCCTCCCAAAGCTGGG - Intergenic
1098486139 12:71024160-71024182 CACCTCAGCCCCAAGTAGCTAGG + Intergenic
1098791334 12:74828024-74828046 CACCTCAGCCTCCTGAAGTGTGG - Intergenic
1099205644 12:79723121-79723143 CACCTCAACCTCCTGTAGCTGGG - Intergenic
1099827837 12:87800803-87800825 CACCTCAACCTCCTGCTCCTGGG - Intergenic
1099969177 12:89483025-89483047 TGCCTCAGCCTCCCATAGCTGGG + Intronic
1099979527 12:89582606-89582628 CATCTCAGCCTCCTGAAGTCTGG - Intergenic
1100445723 12:94657751-94657773 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1100520343 12:95368784-95368806 CACCTCAGCCTCCTGAGTGTAGG - Intergenic
1101000415 12:100352343-100352365 CGGCTCAGCCTCCTGAAGTTGGG - Intergenic
1101182128 12:102230582-102230604 CACCTCCTTCTCCTGTTGCTGGG + Intergenic
1101507558 12:105361142-105361164 CACCGCCACCTCCTGTAGCTGGG + Intronic
1101523888 12:105509858-105509880 CACCTCTCCCTCCTGTACCCTGG - Intergenic
1101642905 12:106601360-106601382 CACCCCAGTCTCCTGTCCCTGGG - Intronic
1101652952 12:106694326-106694348 CATCTCAGCCTCCTGTGAATAGG - Intronic
1101979396 12:109392604-109392626 CTCCTCAGCCTCCCATAGCTGGG - Intronic
1101999888 12:109550748-109550770 CACCTCAGTCTCGAGTAGCTGGG + Intergenic
1102221025 12:111194577-111194599 CATTGCAGCCTCCTGTAGCAGGG + Intronic
1102474851 12:113181901-113181923 CACCTCAGCCTCCCAGTGCTGGG - Intronic
1102726342 12:115068544-115068566 CACCTCAGCCTCCCAAAGTTTGG + Intergenic
1102922021 12:116798680-116798702 CGCCTCAGCCTCCTGAATCTGGG + Intronic
1103085248 12:118057870-118057892 CGCCTCAGCCTCCTGTGTATCGG + Intronic
1103392721 12:120585840-120585862 CACATCAGCCTCATGAAGTTAGG + Intergenic
1103603829 12:122072017-122072039 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
1103739719 12:123083102-123083124 CACCACAGCCTCCTGTAGCTGGG - Intronic
1103789682 12:123460772-123460794 TGCCTCAGCCTTCTGTAGCTGGG + Intronic
1104847685 12:131854937-131854959 GACCTCAGACTCCTGCAGATTGG - Intergenic
1105040617 12:132957860-132957882 TGCCTCAGCCTCCAGTAGTTGGG - Intergenic
1105325154 13:19364174-19364196 CACCTCAGTCTCCTGAGGCTGGG - Intergenic
1105504712 13:20999580-20999602 CATCTCAGCCTCCTGTAGTCAGG + Intronic
1105710378 13:23002408-23002430 TCCCTCAGTCTCCTGTAACTTGG + Intergenic
1106043477 13:26116180-26116202 GAACTCAGCCTCATGTAGCATGG - Intergenic
1106244251 13:27933747-27933769 TGCCTTAGCCTCCTGTGGCTGGG + Intergenic
1106279941 13:28257924-28257946 CACCTCAGCCTCTAGTAGCTGGG + Intronic
1106280198 13:28260278-28260300 TGCCTCAGCCTCACGTAGCTGGG - Intronic
1106334329 13:28769135-28769157 TGCCTCAGCCTCCCGTAGGTGGG + Intergenic
1106789323 13:33138696-33138718 CACTTCTGCCGCCTGCAGCTCGG - Intronic
1107398324 13:40041793-40041815 CACCTCATCTTCCGGTTGCTAGG - Intergenic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1107515882 13:41128907-41128929 CACCTCAGCCCCGAGTTGCTAGG + Exonic
1107644626 13:42481003-42481025 TGCCTCAGCCTCCTGAAGCTGGG - Intergenic
1108214547 13:48171632-48171654 TGCCTCAGCCTCGAGTAGCTGGG + Intergenic
1108802440 13:54116095-54116117 GTCCTCAGCCTCCTGAAGCCTGG - Intergenic
1110186256 13:72678919-72678941 TACCTCAGCCTTGAGTAGCTCGG + Intergenic
1110250861 13:73378858-73378880 CAACTCAGCCTCCTGTCTCTGGG + Intergenic
1110305104 13:73977292-73977314 CACCTCAGCCTCCCAGAGCTGGG + Intronic
1110332015 13:74283971-74283993 TACCTCAGCCTCCCGTAGCTGGG + Intergenic
1110477730 13:75937229-75937251 CACCTCAGCCTCCTGTGTAGTGG + Intergenic
1110574730 13:77042307-77042329 CACCTCAGCCCCAAGTAGCTGGG - Intergenic
1111154070 13:84298979-84299001 TTCCTCAGCCTCCTGTAGCTGGG + Intergenic
1111299688 13:86331760-86331782 TGTCTCAGCCTCCTGTAGCTGGG + Intergenic
1111924516 13:94448129-94448151 CATCTCAGCCTCAAGTAGCTGGG - Intronic
1112025624 13:95408355-95408377 CACCTCAGCCTCCCATAGCTGGG + Intergenic
1112055673 13:95688626-95688648 TGCCTCAGCCTCCTGGGGCTGGG + Intronic
1112148621 13:96730845-96730867 CACCTCAGCTTCCTGTAGCTAGG + Intronic
1112268327 13:97946389-97946411 TACCTCAGCCTCCTGTGTATGGG + Intergenic
1112375432 13:98835851-98835873 TGCCTTAGCCTCCCGTAGCTGGG + Intronic
1112378445 13:98865715-98865737 CAGCCCAGTCTCCTGTACCTGGG - Intronic
1112396413 13:99036653-99036675 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1112472271 13:99699876-99699898 TGCCTCAGCCTCGAGTAGCTGGG - Intronic
1112621815 13:101060914-101060936 CAACTCAACCTCCTATAGCAAGG - Intronic
1112732998 13:102387843-102387865 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1112833263 13:103479489-103479511 TGCCTCAGCCTCAAGTAGCTGGG - Intergenic
1112859429 13:103812042-103812064 TGCCTCAGCCTCCCATAGCTGGG - Intergenic
1112950721 13:104993136-104993158 CATCTCAGCCTCCAGTAGCTGGG - Intergenic
1113123664 13:106952838-106952860 CACCTCAGCCTTGAGTAGCTGGG - Intergenic
1113746321 13:112747354-112747376 CACTGCAGCCTCCCGGAGCTTGG + Intronic
1114007248 14:18328014-18328036 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1114326400 14:21593546-21593568 CACCTCAGCCTCCTAGCACTGGG - Intergenic
1114721410 14:24886291-24886313 CAGCTCAGGCACTTGTAGCTGGG - Intronic
1114928319 14:27433735-27433757 CACCTCAGCCTCCTGAGGAACGG + Intergenic
1115181470 14:30631237-30631259 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
1115209900 14:30956536-30956558 CTCCTCAGCCTCGAGTAGCTAGG - Intronic
1115679393 14:35719210-35719232 TGACTCAGCCTCCAGTAGCTGGG - Intronic
1115843014 14:37493351-37493373 CACCTCAGCTTAATGTAACTTGG - Intronic
1116803933 14:49472860-49472882 CACCTCAGCCTCCTATATTCAGG - Intergenic
1116840277 14:49813717-49813739 CACCTCAGCTTTCTGTAGCTGGG + Intronic
1116899314 14:50346762-50346784 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1117074435 14:52088155-52088177 TACATCAGTCGCCTGTAGCTGGG - Intergenic
1117133586 14:52710313-52710335 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
1117171630 14:53106541-53106563 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1117791850 14:59349994-59350016 CACCCCAGCCTCCCTCAGCTTGG - Intronic
1118267422 14:64308126-64308148 CACCTCAGCCTCCTGAGGAGCGG + Intronic
1118297967 14:64587857-64587879 CAAGTGATCCTCCTGTAGCTAGG + Intronic
1118368183 14:65113496-65113518 CACCTCAGCCTCTTGTGGCTGGG + Intergenic
1118934220 14:70271527-70271549 TACCTCAGCCTCGAGTAGCTGGG - Intergenic
1119043222 14:71294507-71294529 TGCCTCAGCCTCCAGTAGCTGGG + Intergenic
1119053627 14:71395545-71395567 CACCTCAGCCCCCAGTAGCTGGG - Intronic
1119146106 14:72315947-72315969 ATCCCCAGCCTCCTGTGGCTTGG + Intronic
1119239236 14:73045147-73045169 CACCTCAGCCTCCTGAGGGAAGG + Intergenic
1119464803 14:74848437-74848459 CACCTCAGCCTCCTAGCACTGGG - Intronic
1119610003 14:76053623-76053645 CACCTCCGCCTCGTGGAGCAGGG - Intronic
1119807716 14:77493109-77493131 CACTTCAGCCCCCAGTAGCTGGG + Intronic
1119861014 14:77936104-77936126 CACCCCAGCCTCCTCTAGGGAGG - Intergenic
1120108263 14:80521087-80521109 CACCTCAGCCTCCAAGAGCTGGG + Intronic
1120986651 14:90341177-90341199 TGCCTCAGCCTCAAGTAGCTGGG + Intergenic
1121332108 14:93056116-93056138 CACCCCAGCCTTCTCTATCTGGG - Intronic
1121408898 14:93735803-93735825 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
1122496174 14:102157146-102157168 CACCTCAGCCTCTTGTAGCTGGG - Intronic
1122576234 14:102744446-102744468 TGCCTCAGCCTCCAATAGCTGGG + Intergenic
1122700944 14:103588726-103588748 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1122730222 14:103791233-103791255 TGCCTCAGCCTACTGTAGCTGGG + Intronic
1122908021 14:104811385-104811407 CACCTCGGCCTCCTGAAGTGCGG - Intergenic
1123391165 15:19874669-19874691 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1123699157 15:22902013-22902035 GACCTCAGCCTCCTGGTGCCTGG - Intronic
1124111370 15:26792081-26792103 TGCCTCAGCCTCATGTAGCTGGG - Intronic
1124921198 15:34028449-34028471 CACCTCAGCCTTCTGAATATGGG - Intronic
1125445944 15:39756477-39756499 CACCTCAGCCTCCTGATGCTTGG + Intronic
1125636445 15:41192726-41192748 CACCTCAGCCTCGAGTAGCTAGG + Intronic
1125904819 15:43381616-43381638 TGCCTCAGCTTCCCGTAGCTGGG - Intronic
1126196473 15:45937221-45937243 CGCCTCGGCCTCCTGTAGTTTGG + Intergenic
1126473579 15:49042912-49042934 TGCCTCAGCCTCCTGAAGCTGGG - Intronic
1126594041 15:50368327-50368349 CACCTCGGCCTCCTAGTGCTGGG - Intergenic
1126611586 15:50535023-50535045 TGTCTCAGCCTCCAGTAGCTGGG - Intronic
1126625486 15:50682460-50682482 TGCCTCAGCCTCTAGTAGCTGGG - Intronic
1126836792 15:52675790-52675812 TGCCTCAGCCTTCGGTAGCTGGG - Intronic
1127370935 15:58339909-58339931 CACTTCAGCCTCCCGAAGTTCGG + Intronic
1127895340 15:63293876-63293898 CACTTCAGCCTCAAGTAGCTGGG + Intronic
1127945147 15:63744202-63744224 CTCCTCAGCCACCTAAAGCTGGG + Intronic
1128146730 15:65336117-65336139 TACCCCAGCCTCCAATAGCTAGG + Intronic
1128977241 15:72162786-72162808 CTCATCAGCCTCCTCTGGCTCGG - Intronic
1129003625 15:72354281-72354303 CACCTCAGCTCCCTATAGCTGGG - Intronic
1129014028 15:72450102-72450124 TGCCTCAGCCTCCCGTAGCAGGG + Intergenic
1129174842 15:73832559-73832581 CCCCTCAGTCTCCTGAAGCAGGG + Intergenic
1129347972 15:74936437-74936459 CACCTCAGCCTCCCAAAGTTTGG - Intronic
1129490581 15:75921545-75921567 TGCCTCAGCCTACAGTAGCTGGG - Intronic
1129795564 15:78373560-78373582 TGCCTCAGCCTCCTATAGCTGGG + Intergenic
1129972595 15:79792999-79793021 AACCTCCGCCTCCTGTAGCTGGG + Intergenic
1130292254 15:82613499-82613521 CACCTCAGCCCCAAGTAACTGGG + Intronic
1130565893 15:84994846-84994868 TGCCTCAGCCTCTAGTAGCTAGG - Intronic
1130608554 15:85339497-85339519 CAGGTGATCCTCCTGTAGCTGGG - Intergenic
1130712908 15:86301372-86301394 GACCTCAGCCTCTTGTCTCTTGG + Intronic
1130777049 15:86995270-86995292 CACCTCAGCCTCCTGATAGTTGG - Intronic
1131154477 15:90066589-90066611 TGCCTCAGCCTCCTATAGCTGGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1131608761 15:93938578-93938600 CACCTCGGCCTCCAGAAGCTGGG - Intergenic
1132484331 16:182471-182493 TGCCTCAGCCTCCTGAAGTTGGG - Intergenic
1132597694 16:760802-760824 CACCTGAGCCTCCTCTGCCTCGG - Intronic
1132773069 16:1575437-1575459 CACCTCAGCCTCCTGAGCGTGGG - Intronic
1132890653 16:2202813-2202835 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1133132056 16:3682745-3682767 CACATCAGCCCCCTGTAGCTAGG - Intronic
1133153643 16:3856237-3856259 CGCTTCAGCCCCCTATAGCTGGG + Intronic
1133159538 16:3901283-3901305 AGCCTCAGCCTCCTGAAGCTGGG - Intergenic
1133261450 16:4553451-4553473 CACTGCAGCCTCGAGTAGCTGGG + Intergenic
1133420213 16:5639691-5639713 CACCTCAGCCACCTACAGCCTGG - Intergenic
1133778106 16:8913862-8913884 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1134041490 16:11072233-11072255 CACCTCAGCCTGTAGTATCTGGG + Intronic
1134068036 16:11241964-11241986 CACCTCAGCCTCCTGGGTATTGG + Intergenic
1134399828 16:13899590-13899612 TGCCTCAGCCTACAGTAGCTGGG - Intergenic
1134458795 16:14414193-14414215 CACCTCAGCTGGCAGTAGCTGGG + Intergenic
1134568663 16:15273137-15273159 CACCTCAGCCTCCTGAGCATAGG - Intergenic
1134733770 16:16483225-16483247 CACCTCAGCCTCCTGAGCATAGG + Intergenic
1134933730 16:18229057-18229079 CACCTCAGCCTCCTGAGCATAGG - Intergenic
1135020465 16:18958535-18958557 TGCTTCAGCCTCCTGTAGCTGGG - Intergenic
1135223046 16:20630199-20630221 AACCTCCGCCTCCAGTAGCTGGG + Intronic
1135292047 16:21248271-21248293 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1135330883 16:21558612-21558634 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
1135720746 16:24815737-24815759 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1135733019 16:24910065-24910087 AACCCCATCCTCCTGTTGCTGGG - Intronic
1135881271 16:26259974-26259996 CATTTCAGCCTCATGTAGATGGG - Intergenic
1136115236 16:28090383-28090405 TGCCTCAGCCTCGAGTAGCTGGG + Intergenic
1136341779 16:29648727-29648749 TGCCTCAGCCTCGAGTAGCTGGG + Intergenic
1136591447 16:31220159-31220181 AATCTCAGCCTCCCATAGCTGGG + Intronic
1137544264 16:49389305-49389327 CAGCCTAGCCTCCTGTAGCTGGG - Intronic
1137778345 16:51075280-51075302 CACCTCAGCCTCCACTTCCTGGG - Intergenic
1137789125 16:51159904-51159926 AACCTCACCCTCCAGTTGCTGGG - Intergenic
1138408566 16:56819571-56819593 CACCTCATCCTCCTCCAGCCTGG + Intronic
1138438857 16:57022374-57022396 CTCCACAGCCTCCTCCAGCTTGG - Intronic
1138487718 16:57357581-57357603 GACCCCAGCCTCCTAGAGCTTGG + Intergenic
1138558272 16:57785533-57785555 CACCAGCTCCTCCTGTAGCTGGG + Intronic
1138645009 16:58418426-58418448 CACCTCAGCCTCCCAAAGATTGG + Intergenic
1139425471 16:66877250-66877272 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
1139595067 16:67952673-67952695 TGCCTCAGCCTCCAGTTGCTGGG - Intronic
1139825374 16:69752971-69752993 CACCTCAGCCTCCTGTAGTGAGG - Intronic
1140132329 16:72174496-72174518 CACCTCGGCATACTCTAGCTAGG - Intronic
1140339329 16:74141513-74141535 CACCTCAGCCTCCTAGTGTTGGG - Intergenic
1140464337 16:75167711-75167733 CACCTCAGCCTGGAGTAGCTGGG + Intronic
1140521264 16:75584114-75584136 CACCTTGGCTTCCTGTAACTTGG + Intergenic
1140847627 16:78905493-78905515 CACCTCAGCCTCCTGTGTAGTGG + Intronic
1141210467 16:81974559-81974581 CGCCTCAGCCTCCCAAAGCTGGG - Intergenic
1141434433 16:83991601-83991623 CGCCTCAGCCTCCAGGTGCTGGG + Intronic
1141793718 16:86254282-86254304 CTCCTCAGCCTCCCGGTGCTGGG + Intergenic
1142043908 16:87913092-87913114 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1142498722 17:320523-320545 CACCTCAGCCTTAAGTAGCTAGG - Intronic
1142556645 17:782673-782695 CACCTCAGCCTCCTGTCCCCGGG - Exonic
1142652920 17:1368260-1368282 CGCCTCAGCCTCGAGTAGCTGGG - Intronic
1142711955 17:1728243-1728265 AGCCTCAGCCTCCTGGGGCTGGG - Exonic
1143002614 17:3804430-3804452 CACCATAGCCTCCCGAAGCTGGG - Intergenic
1143098231 17:4489897-4489919 CACCTCAGCCTCCCAGAGCTGGG - Intergenic
1144530648 17:16035655-16035677 CACCTCAGACCCAAGTAGCTGGG + Intronic
1144713956 17:17421506-17421528 CACCTGTGCCTCCTGCACCTGGG + Intergenic
1144847493 17:18227500-18227522 CATCTCAGCCTCCTGAAGCTGGG + Intronic
1144938539 17:18919550-18919572 CACCTCACTCTCAAGTAGCTGGG - Intronic
1145350793 17:22081301-22081323 CACCTCAGCCTCCTGAAGGCTGG - Intergenic
1145373810 17:22329232-22329254 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1145721920 17:27081773-27081795 CATCTCAGCCTCCAATAGCTGGG - Intergenic
1145856690 17:28165964-28165986 CACCTCAGCCTCCCAGTGCTGGG - Intronic
1146191752 17:30774025-30774047 CACCTCAGCCTCCCGAAGTGTGG + Intronic
1146975143 17:37104824-37104846 CACCTCAGTCCCAAGTAGCTAGG - Intronic
1147154707 17:38538168-38538190 CACCTCAGCCTCCCAGTGCTGGG - Intronic
1147392549 17:40119302-40119324 CACCTCAGCCACCCAAAGCTGGG - Intergenic
1147591190 17:41684410-41684432 CTCCTCAGGCTCCTGGGGCTGGG + Intergenic
1147714573 17:42496723-42496745 TTCCACAGCCTCCTGTAGCTGGG - Intronic
1147858627 17:43502536-43502558 TGCCTCAGCCTCAAGTAGCTGGG + Intronic
1147960318 17:44163411-44163433 TGCCTCAGCCTCCGGAAGCTGGG + Intergenic
1148142607 17:45339152-45339174 CACCTCAGGCTCCTGAGTCTGGG - Intergenic
1148599577 17:48884025-48884047 CACCTCAGCCTCCTGAGGCCCGG + Intergenic
1148713951 17:49702232-49702254 CACCTCAGCCCCGAGTAGCTGGG + Intronic
1148727816 17:49808233-49808255 TGCCTCAGCCTCAAGTAGCTGGG + Intronic
1149569899 17:57665059-57665081 TACCCCAGCCTCCTCTAACTGGG + Intronic
1149667932 17:58379083-58379105 GACCTCAACCTCCTTTAACTGGG - Intronic
1149828462 17:59850563-59850585 TGCCTCAGCCTCGAGTAGCTGGG - Intergenic
1149916720 17:60616117-60616139 AGCCTCAGCCTCCTGTAACTGGG + Intronic
1150048693 17:61937783-61937805 TGCCTCAGCCTCGAGTAGCTGGG - Intergenic
1150195542 17:63294358-63294380 CATTTCAGCCTCCTGTAGCTGGG - Intronic
1150377413 17:64693337-64693359 TGCCTCAGCCTCCTCTAGCTGGG + Intergenic
1150889821 17:69134994-69135016 TACCTCAGCCTCCCAAAGCTGGG + Intronic
1151312522 17:73302588-73302610 CACCTCAGTCCCGAGTAGCTGGG + Intronic
1151324264 17:73369214-73369236 CAGCTCAGCCTCCCGTAGGACGG - Intronic
1151330457 17:73403456-73403478 CACCTCACGCTCCTGTTTCTAGG + Intronic
1151337979 17:73451388-73451410 TGCCTCAGCCTCCAGTAGCTGGG - Intronic
1151464746 17:74277269-74277291 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
1151599664 17:75098448-75098470 TGCCTCAGCCTCGAGTAGCTGGG - Intronic
1151628251 17:75291444-75291466 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1151856396 17:76725290-76725312 TGCCTCAGCCTCCTGTAACTGGG - Intronic
1151965876 17:77431090-77431112 CACCGCAGCCTCCCAAAGCTGGG - Intronic
1152055143 17:78018748-78018770 CAGCTCAGCCTCCTCTAGGCTGG - Intronic
1152150419 17:78596614-78596636 CACCTCAGCCTCCTGCATAATGG + Intergenic
1152550935 17:81029796-81029818 CACCTCAGCCTCTAGTGGCTAGG + Intergenic
1152699619 17:81812484-81812506 CACCTGACCCTCCTGCAGGTGGG - Intronic
1152765104 17:82132666-82132688 CACCTCAACCTCCTGAGTCTGGG + Intronic
1152778191 17:82214914-82214936 CACCTTGGCCTCAGGTAGCTGGG - Intergenic
1152778443 17:82215996-82216018 CACCTTGGCCTCAGGTAGCTGGG + Intergenic
1152833331 17:82512613-82512635 TGCGTCAGCCTCCCGTAGCTGGG - Intergenic
1153288033 18:3474572-3474594 TGCCTCAGCCTCCTACAGCTGGG + Intergenic
1153316214 18:3724793-3724815 CACCTCAGCCTCCTGAACTCAGG - Intronic
1153569108 18:6450730-6450752 CACCTCAGCCTCCTATAGTTAGG - Intergenic
1153849476 18:9079682-9079704 CACCTCCGCCTACTAAAGCTAGG + Intergenic
1153860707 18:9202074-9202096 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1154183512 18:12158637-12158659 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1154194335 18:12254644-12254666 CTCCTCACCCTCTTGCAGCTGGG + Intronic
1154222122 18:12465288-12465310 CACCTCAGACTCCAGTAGCCAGG + Intronic
1154265916 18:12878731-12878753 CACCTCAGCCTCTTGGAAATTGG - Intronic
1154329672 18:13419443-13419465 CACCCCAGCCTCCTGTAGCCTGG - Intronic
1154530219 18:15335977-15335999 CACCTCAGCCCAGAGTAGCTGGG + Intergenic
1155462858 18:26103137-26103159 TGCCTCAGCCTCAAGTAGCTGGG + Intergenic
1155467112 18:26148958-26148980 CACCTCAGCCTCCTGAATGCAGG + Intronic
1155583430 18:27338396-27338418 TGCCTCACCCTCCTGAAGCTGGG - Intergenic
1155645120 18:28068163-28068185 CAAATCAGCCTCCTGAAGCAAGG + Intronic
1155810141 18:30222293-30222315 TGCCTCAGCCTCCAGTAGCTGGG - Intergenic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1156677015 18:39539610-39539632 TGCCTCAGCCTCCTGTAGCTAGG + Intergenic
1157825501 18:50808570-50808592 CACCTCAGCCCTGAGTAGCTGGG + Intronic
1158144671 18:54298702-54298724 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
1158521302 18:58173582-58173604 CACCTCAGTCCCCTTTACCTAGG + Intronic
1158897531 18:61929034-61929056 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
1158907807 18:62030894-62030916 CACCTCAGCCTCGAGTAGCTGGG - Intergenic
1159510071 18:69386513-69386535 CACCTCAGCCTCCTAAAGTTGGG - Intergenic
1160094837 18:75861876-75861898 CCCCTCAGCCTTCTGCAGTTTGG - Intergenic
1160223456 18:76993434-76993456 TGCCTCAGCCCCCTGAAGCTGGG - Intronic
1160693138 19:469329-469351 CACCTCAGCCTCCTAACTCTGGG + Intronic
1160930039 19:1566303-1566325 CACCACAGCCTCCTGTCTTTTGG - Intronic
1161095425 19:2387629-2387651 CACCTCAGCCTCCCATAGCTGGG - Intergenic
1161276963 19:3423792-3423814 CCCCTCAGCCTCCTCTCTCTGGG + Intronic
1161295482 19:3517946-3517968 CACCTCAGCCTCCTGAGTCCTGG + Intronic
1161325417 19:3661341-3661363 CGCCCCAGCCTCTTGCAGCTAGG + Intronic
1161383468 19:3978687-3978709 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1161409969 19:4111703-4111725 CACCTCAGCCTCCCGGAGTGCGG - Intronic
1161431623 19:4235811-4235833 CACCTCAGCCTCTTGTAACTGGG - Intronic
1161508013 19:4654455-4654477 CACCTCAGCCCCGGGTAGCTGGG + Exonic
1161522663 19:4733707-4733729 CACCTCAGCCTCCTGTGTAGTGG - Intergenic
1161611015 19:5242808-5242830 CATCTCAGCCTTGAGTAGCTGGG + Intronic
1161760084 19:6164677-6164699 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1161867069 19:6840891-6840913 CACTTCAGCCTCGAGTAGCTGGG + Intronic
1161884435 19:6982912-6982934 CACCTCAGCCTTGAGTAGCTGGG - Intergenic
1161910116 19:7187193-7187215 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
1161915322 19:7224057-7224079 CACCTCAGCCTCCAGTAGCTGGG + Intronic
1162089927 19:8272644-8272666 TGTCTCAGCCTCCTGTAGCTGGG - Intronic
1162092159 19:8287500-8287522 TGTCTCAGCCTCCTGTAGCTGGG - Intronic
1162423597 19:10580411-10580433 CATCTCAGCCTCCCATAGTTCGG - Intronic
1162426558 19:10600285-10600307 TGCCTCAGCCTCCCGTTGCTGGG - Intergenic
1162563525 19:11431995-11432017 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1162641642 19:12014820-12014842 CACCTCAGCCTCCTAAAGCCTGG + Exonic
1162663419 19:12189601-12189623 CACCTCAGCCTCCTAAAGTCTGG + Exonic
1162942627 19:14022370-14022392 CACCTCAGCCTCCTGTGTAGGGG + Intergenic
1163256896 19:16161426-16161448 CACCCCGCCCTCCTATAGCTCGG + Exonic
1163345489 19:16739241-16739263 CATCTCAGCCTCCTGAAGTGCGG - Intronic
1163598128 19:18232247-18232269 CACCTCAGTCTCGAGTAGCTGGG - Intronic
1163823087 19:19507501-19507523 CACCTCTGCCTGCTCCAGCTTGG + Exonic
1163970040 19:20784104-20784126 CATCTCAGCCTCAAGTTGCTGGG + Intronic
1164145013 19:22506895-22506917 TTCCTCAGCCTCCCGTAGCTGGG + Intronic
1164599090 19:29549022-29549044 CACCCCAGTGTTCTGTAGCTTGG + Intronic
1164876866 19:31697049-31697071 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1164974541 19:32562090-32562112 TGCCTCAGCCTCCGGAAGCTGGG - Intergenic
1165078500 19:33294151-33294173 CACCTGCGGCTCCTGCAGCTTGG + Intergenic
1165112655 19:33511314-33511336 CAGCTCATCCTCCCGTAGTTTGG + Intronic
1165134980 19:33662192-33662214 CGCATCAGCCCCCAGTAGCTGGG + Intronic
1165187918 19:34037982-34038004 CTCCTTAGCCTCCTGCAACTTGG + Intergenic
1165329898 19:35135498-35135520 CAACACACCCTCCTGTAGCCAGG - Intronic
1165396689 19:35568264-35568286 CGCCTCAGCCTCCTAGTGCTGGG - Intergenic
1165530084 19:36391578-36391600 CACCTCAGCCTCGAGTAGCTAGG + Intronic
1165569643 19:36764800-36764822 AACCTCAGCCTCCTTTAGCTGGG + Intronic
1165747491 19:38238656-38238678 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
1165775330 19:38401079-38401101 CACCTCAGCCTCCTGAAAGGCGG + Intergenic
1165881080 19:39044176-39044198 TGCCTCAGCCTTGTGTAGCTGGG - Intergenic
1166098878 19:40559043-40559065 CACTTCAGCCTCGAGTAGCTGGG + Intronic
1166116828 19:40661463-40661485 CACCTCAGCTTCCTGTTACTGGG + Intergenic
1166168237 19:41007737-41007759 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1166181307 19:41111132-41111154 CACCTCAGCCTCCTATAGCTAGG + Intergenic
1166199737 19:41229197-41229219 CACCTCGGCCTCCTAAGGCTGGG + Intronic
1166285690 19:41826366-41826388 CACCTCAGCCTCCCAAAGTTGGG + Intergenic
1167277979 19:48550345-48550367 CAGCTCAGCCTCCTGGAGACGGG + Intergenic
1167291337 19:48626698-48626720 TGCCTCACCCTCCTGTAGCTGGG - Intronic
1167483474 19:49746718-49746740 CTCCTCCGGCTCCTGCAGCTCGG + Exonic
1167513113 19:49907260-49907282 CACCTGAGCTTCGGGTAGCTGGG + Intronic
1167561646 19:50229524-50229546 CACCTCAGCCTCAAGTAGCTGGG - Intronic
1167586821 19:50380058-50380080 CTCCTCAGCCTCGAGTGGCTGGG - Intronic
1167701598 19:51051050-51051072 CACCTCAGCCTCCCGAAGTGCGG - Intergenic
1168047479 19:53804510-53804532 TACCTCAGTCTCGAGTAGCTGGG + Intronic
1168080118 19:54003969-54003991 CACCTCATCCTCGAGTAGCTGGG + Intronic
1168184343 19:54688872-54688894 CACCTCACGCTCCCGTGGCTAGG - Intronic
1168455391 19:56503797-56503819 CGCCTCAGCCTCCCATAGCTGGG + Intergenic
925565432 2:5248738-5248760 CACCTCAGTCTTGAGTAGCTGGG - Intergenic
925826624 2:7854998-7855020 TGCCTCAGCCTCCCGAAGCTGGG - Intergenic
926024046 2:9524374-9524396 CACCTCAGCCTCCTCTAGCTGGG - Intronic
926179250 2:10626064-10626086 TACCTCAGCCCCATGCAGCTGGG - Intronic
926181123 2:10644132-10644154 TACCTCAACCTCCTGTAGCTGGG - Intronic
926227211 2:10975850-10975872 TGCCTCAGCTTCCTGTAGCTGGG - Intergenic
926242893 2:11101667-11101689 CACCTAAGCCTCCAGCAGCCAGG + Intergenic
927769208 2:25843686-25843708 CATCTCTGCCTCCTGAAGCTGGG - Intronic
928551851 2:32380476-32380498 CGCCTCAGCCTCCCTCAGCTGGG - Intronic
929100921 2:38312593-38312615 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
929157507 2:38801352-38801374 CACCTCAGCCTCTGGCAGTTGGG + Intronic
929470103 2:42183039-42183061 CACCTCAGCCTCCTGATACCTGG - Intronic
929514263 2:42592146-42592168 TGCCTCAGCCTCCCTTAGCTGGG - Intronic
929525050 2:42693824-42693846 CACCATAGCCACCTATAGCTGGG + Intronic
929585139 2:43108945-43108967 TACCTCAGCCTCCCATAGCTGGG - Intergenic
929787348 2:45002178-45002200 CTCCTCTGCCCCCTGTAGCCCGG + Intergenic
929836767 2:45409106-45409128 CACCTCAGCCCCAAGTAGCTGGG - Intronic
929872867 2:45773239-45773261 GGCCTCACCCTCCTGTAGCCTGG - Intronic
930060702 2:47286098-47286120 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
930224999 2:48783347-48783369 CACCTCAGCCTCCTAAAGTCTGG + Intergenic
930291019 2:49492378-49492400 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
930326857 2:49931016-49931038 CACCTCGGACTCGAGTAGCTAGG - Intronic
930715927 2:54594077-54594099 CACCTCGGCCTCCCAAAGCTGGG + Intronic
930759005 2:55011273-55011295 CACCTCAGCCTCCTAAAGTGCGG + Intronic
931682327 2:64761270-64761292 TGCCTCAGCTTCCTGTAGCTGGG - Intergenic
932224616 2:70029806-70029828 CTCCTCAGCCTCCTCTAGGGAGG - Intergenic
932262213 2:70336519-70336541 CCCTTCAGCCTCCAGTAGCTGGG - Intergenic
932309403 2:70727644-70727666 CACCTCAGCCTCCTAAAGTGCGG - Intronic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932615581 2:73229231-73229253 CACCTCAGCCTCGAGTAGCTGGG + Intronic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
932636595 2:73394463-73394485 TGCCTCAGCCTCCAGTAACTGGG + Intronic
932650591 2:73551548-73551570 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
933449378 2:82427477-82427499 TACCTCAGCCTCCCAAAGCTGGG - Intergenic
933789863 2:85875171-85875193 TGCCTCAGCCTCCCGTAGCTAGG + Intronic
933844373 2:86313753-86313775 CACCACAGCCTGCAGTAACTGGG + Intronic
933867416 2:86534310-86534332 TACCTCAGCCTCCCGTACCTGGG + Intronic
934058031 2:88268992-88269014 CACCTCAGCCTCCTGAGTATCGG + Intergenic
934572075 2:95379136-95379158 CACCTCAGCCTCCTGGGGGATGG - Intronic
934672497 2:96223675-96223697 TGCCTCAGCCTCCCGAAGCTGGG + Intergenic
934711423 2:96516869-96516891 TGCCTCAGACTCCCGTAGCTGGG - Intergenic
935002518 2:99033590-99033612 CACCTCAGCCTCCCAGTGCTGGG - Intronic
935574847 2:104698675-104698697 CAACTTAACCTCATGTAGCTTGG - Intergenic
935642257 2:105301850-105301872 TGCCTCAGCTTCCTGTGGCTGGG + Intronic
935647245 2:105349343-105349365 TGCTTCAGCCTCCTGTAGCTGGG + Intergenic
935728712 2:106046874-106046896 CACTTCAGCCCCTAGTAGCTGGG - Intergenic
936046132 2:109189201-109189223 CACCAGAGCCTCCTCTATCTCGG - Intronic
936251661 2:110872658-110872680 CCCTGCAGCCTCCTGGAGCTGGG - Intronic
936789356 2:116132908-116132930 TACCTCAGCCTCCCATAGCTGGG + Intergenic
937431273 2:121840793-121840815 TGCCTCAGCTTCCAGTAGCTGGG + Intergenic
937857849 2:126685631-126685653 CACCTCAGCCTCCCAAAGTTGGG + Intronic
937898053 2:126993584-126993606 TGCCTCAGCCTCCTGAGGCTGGG - Intergenic
937922762 2:127143522-127143544 CACCTCAGCCTCCCGGTGCTGGG - Intergenic
938032436 2:128006664-128006686 TACCTCAGCCTCCCAAAGCTGGG - Intronic
938529320 2:132167436-132167458 CACCTCAGCCCAGAGTAGCTGGG + Intronic
938645949 2:133330178-133330200 CAGCTCAGCCTCCTGAATATGGG + Intronic
938710871 2:133975381-133975403 CACCTCAGCCTCCTGTTTCCAGG - Intergenic
938846050 2:135210445-135210467 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
938847328 2:135223003-135223025 CACCTCAGCCTCCCGAAGTGCGG - Intronic
939027540 2:137031953-137031975 CACCTCAGCTTCAACTAGCTGGG + Intronic
939153635 2:138500779-138500801 CAACTCAGCCTCCCGTAGCTGGG - Intergenic
939734983 2:145833086-145833108 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
939751401 2:146051650-146051672 TACCTCAGCCTCCAGTAGCTGGG - Intergenic
940214560 2:151290827-151290849 CACCTCAGCCTCCTGTAAAATGG + Intergenic
940898268 2:159102391-159102413 CACCTCAGCCTCAAGTAGCTGGG + Intronic
940898525 2:159104660-159104682 CACCTCAGCCTCAAGTAGCTGGG + Intronic
941282933 2:163575358-163575380 CATCTCAGCCTCCCGTAGCTGGG + Intergenic
941601343 2:167546996-167547018 CTCCTCAGCCTCCATGAGCTGGG + Intergenic
941837506 2:170041092-170041114 CACCTCAGCCTCCTAAAGTGCGG - Intronic
941968961 2:171329144-171329166 AACCTCTGCCTCCTGTAGCCAGG - Intronic
942247647 2:174022709-174022731 CACCTCAGCTCCAAGTAGCTGGG - Intergenic
942383258 2:175415619-175415641 CACCTCAGCCTCAAGTAGCTGGG + Intergenic
942402024 2:175612891-175612913 TGCCTCAGCCTCCCGTAGTTGGG + Intergenic
942535165 2:176955740-176955762 CACATCAGCCCACTGCAGCTTGG + Intergenic
942897098 2:181070272-181070294 CTCCTCAGCCTCCTAATGCTGGG - Intronic
943145879 2:184044277-184044299 CACCTCAGCCTCCTATAGCTGGG + Intergenic
943597706 2:189878104-189878126 TGCCTCAGCCTCCCGTAACTGGG + Intergenic
944229423 2:197377950-197377972 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
944771623 2:202920266-202920288 TGCCTCAGACTCCTGTAGCTGGG + Intronic
945525143 2:210878843-210878865 TGCCTCAGCCTCTTGTAACTGGG - Intergenic
945588790 2:211701640-211701662 TGCCTCAGCCTCCGGTAGCTGGG - Intronic
945607704 2:211956945-211956967 CACCTCAGATTCCTGTGTCTAGG + Intronic
946198083 2:218050332-218050354 CACTCCTGCCTACTGTAGCTTGG - Intronic
946253867 2:218429693-218429715 CCCCTCAGCCTACTGCAGCCTGG + Intronic
946277313 2:218641358-218641380 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
946522283 2:220479429-220479451 CACCTCAGCCTCCCTCAGCTGGG - Intergenic
946566399 2:220970429-220970451 TGCCTCAGCCTCAAGTAGCTGGG - Intergenic
946597922 2:221326981-221327003 CACCTCAGCCTCCTGAGACGGGG - Intergenic
946906317 2:224419758-224419780 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
947507059 2:230715814-230715836 CACCTCAGCCTCCTGTAGACGGG + Intronic
947730828 2:232430444-232430466 TGCCTCAGCCTCGGGTAGCTGGG + Intergenic
947775768 2:232708074-232708096 CACCTCAGCCTCCTGAGTATAGG + Intronic
948179965 2:235972025-235972047 CACCTCAGCCTCCCAGTGCTGGG + Intronic
948601228 2:239108461-239108483 CTCCTCAGCCTGCTGCAGCAGGG - Intronic
948824743 2:240568704-240568726 CGCCTCCGCCACCTGCAGCTGGG + Exonic
1168775128 20:440972-440994 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
1169043007 20:2511222-2511244 CACCTCAGCCCCGAGTAGTTGGG + Intronic
1169079033 20:2783450-2783472 CACCTCAGCCTCCTGAATAGTGG - Intergenic
1169102248 20:2960495-2960517 CACCTCGGCCTCCCAAAGCTGGG + Intronic
1169133697 20:3182685-3182707 CACCTCAGCTTCCTGTAGCTGGG + Intergenic
1169420499 20:5455213-5455235 CACCTCAGCCTCGAGTAGCTAGG + Intergenic
1170697267 20:18670205-18670227 CACCTCAGCCTCCCAAAGCGTGG - Intronic
1170971848 20:21124267-21124289 CACCTCAGCCTCCTCTTGGCCGG - Intergenic
1171206080 20:23282625-23282647 CACCTCCCCCTCCTGTTTCTGGG - Intergenic
1171458101 20:25283123-25283145 GGCCTCAGCCTCCTGAGGCTGGG - Intronic
1171528989 20:25839175-25839197 AACCTCAGCCTCCCATAGCTGGG + Intronic
1171547837 20:26016710-26016732 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1171796831 20:29572968-29572990 CACTTGAGCCTTTTGTAGCTTGG + Intergenic
1172300911 20:33849482-33849504 TGCCTCAGCCGCCAGTAGCTGGG - Intronic
1173363215 20:42362988-42363010 TGCCTCAGCCTCAAGTAGCTAGG - Intronic
1173470080 20:43316674-43316696 CACCTAAAACTCCTGTTGCTGGG - Intergenic
1173904583 20:46616812-46616834 CACCTCAGCCTTCTTAGGCTGGG + Intronic
1174126888 20:48312933-48312955 TGCCTCAGCCTCCCATAGCTGGG - Intergenic
1174169644 20:48607994-48608016 TGCCTCAGCCTCCGGTAGCTGGG - Intergenic
1174436875 20:50514612-50514634 CACCTTGGCCTCCTGAAGTTGGG + Intronic
1174473267 20:50777142-50777164 TGCCTCAGCTTCCCGTAGCTGGG + Intergenic
1174624880 20:51905800-51905822 CACCTCAGCCTCCCAGAGCCTGG + Intergenic
1174820223 20:53720221-53720243 CACCTCAGCCTCCCAAAGCGCGG - Intergenic
1174897342 20:54464046-54464068 CACCTCATCTTCCTTTATCTAGG - Intergenic
1175208014 20:57326856-57326878 CAGCTCACCCTCCAGCAGCTAGG - Intergenic
1175424173 20:58853814-58853836 CACCTGGGCCTCCTGGAGCAAGG - Exonic
1176767190 21:13032481-13032503 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1177784811 21:25660167-25660189 CACCTCAGCCTCCCAAAGCCTGG + Intronic
1178041341 21:28643562-28643584 CACCTAAGCCTCCAGTAGCTGGG - Intergenic
1178215829 21:30597499-30597521 CACGCCATTCTCCTGTAGCTAGG + Intergenic
1178590736 21:33907588-33907610 CACCTCAGCCTCCAGTAGTTGGG - Intronic
1178860167 21:36282302-36282324 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
1178985980 21:37303515-37303537 CACCTTGGCCTCCTGAAGCTGGG + Intergenic
1179480218 21:41672222-41672244 CACCTTAGCCACCTGTGGCCTGG + Intergenic
1179680910 21:43020769-43020791 CACCTGTGCCTCCTGCAGCGAGG - Intronic
1180431755 22:15258821-15258843 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1180514313 22:16126744-16126766 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1180567895 22:16690761-16690783 CACCTCAGCCACATGTCCCTAGG - Intergenic
1180576976 22:16786159-16786181 CACCTCAGCCTCCTAAAGGTAGG - Intronic
1181032682 22:20155902-20155924 CACCTCAGCCTCCCGTGTATTGG + Intergenic
1181382972 22:22521504-22521526 CACCTCAGCCTTTGATAGCTGGG - Intergenic
1181461284 22:23087348-23087370 CACCTGAGCCTCGAGTAGCTGGG - Intronic
1181510748 22:23387705-23387727 CACCTCAGCCTCCTGTGTATTGG - Intergenic
1181597326 22:23924640-23924662 TGCCTCAGCCTCAAGTAGCTGGG - Intergenic
1182197887 22:28537880-28537902 CACCTCAGCCTCCCATAGCTGGG - Intronic
1182442130 22:30370789-30370811 CCCTTCAGCCTCCTCCAGCTGGG - Exonic
1182625322 22:31641564-31641586 CACCTCAGCCTCCCAAAGCTGGG - Intronic
1182637475 22:31740172-31740194 TGCCTCAGCTTCCTGTAGCTGGG + Intronic
1183062679 22:35345645-35345667 CAGCTCAGCACCCTGCAGCTGGG - Intronic
1183154849 22:36066880-36066902 TGCCTCAGCCTCGAGTAGCTGGG - Intergenic
1183439187 22:37813590-37813612 CACCTGGGCCTCCTGCAGCTTGG - Exonic
1183516429 22:38269462-38269484 CACCTCAGCCTCCCAAAGCTTGG + Intronic
1183593787 22:38797448-38797470 TGTCTCAGCCTCCTGTAGCTGGG + Intergenic
1183754461 22:39747235-39747257 CTCCTCAGCCTCCCGAAGCTGGG + Intronic
1183769545 22:39912302-39912324 TGCCTCAGCCTCCTGTAGCTAGG - Intronic
1183807330 22:40222273-40222295 CACCTCAGCATTCTGTAGAGCGG - Intronic
1183807539 22:40224118-40224140 TGCCTCAGCCTCTCGTAGCTGGG + Intronic
1184199253 22:42954507-42954529 CACTTGAGCCTTCTGAAGCTTGG + Intronic
1184733640 22:46385206-46385228 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1185001018 22:48245840-48245862 CGCCTCAGCCTCCTACTGCTGGG - Intergenic
1185402439 22:50625946-50625968 GACCTCAGCCCCCTGCTGCTGGG - Exonic
949898448 3:8790076-8790098 CACTTCAGTCTCCCGTAGCTGGG - Intronic
950065286 3:10107399-10107421 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
950077969 3:10200646-10200668 CGCCTCAGCCTCACGGAGCTGGG - Intronic
950743489 3:15068294-15068316 CACCTCAGCCCCGAGTAGCTTGG + Intergenic
950977304 3:17261634-17261656 CACCTCAGCCTCCTGGTAGTTGG + Intronic
951209996 3:19964725-19964747 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
951738907 3:25898516-25898538 TGCCTCAGCCTCCCGCAGCTGGG + Intergenic
951965674 3:28381912-28381934 CACCTTGGCCTCCTATTGCTGGG - Intronic
952282178 3:31934520-31934542 TGCCTCAGCCTCCTGAAGCTGGG + Intronic
952282833 3:31939847-31939869 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
952283139 3:31942419-31942441 TCTCTCAGCCTCTTGTAGCTGGG - Intronic
952309086 3:32170856-32170878 CACCTCAGCCCCGAGTAGCTGGG - Intergenic
952454097 3:33456840-33456862 CAGCTCAGGCTCCCTTAGCTGGG + Intergenic
952509771 3:34041363-34041385 TGCCTCAGCCTCCTGAAGCTGGG - Intergenic
953044859 3:39285264-39285286 CATCTCAGCCTCCCATAGCTGGG - Intergenic
953065796 3:39469554-39469576 CCCCTCAGCCTCCTTTAGTCTGG + Intronic
953135047 3:40175025-40175047 TGCCTCAGCCTCCAGTAGCTGGG - Intronic
953157762 3:40390443-40390465 CATCTCAGCCTCCCAAAGCTGGG + Intronic
953756938 3:45654716-45654738 CACCTCAGCCTTGAGTAGCTGGG - Intronic
954020778 3:47739438-47739460 AACCTCAGCCTTGAGTAGCTGGG + Intronic
954173984 3:48828604-48828626 CACCTCAGCCTGGAGTAGCTGGG - Intronic
954246535 3:49336636-49336658 TGCCTCAGTCTCCCGTAGCTGGG + Intronic
954273507 3:49527406-49527428 TGCCTCATTCTCCTGTAGCTGGG - Intronic
954480274 3:50793470-50793492 TGCCTCAGCCTCCCGTAGGTGGG + Intronic
954567822 3:51613649-51613671 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
954578520 3:51690281-51690303 CACCTCAGCCTCCTAAAGTGTGG - Intronic
954618675 3:51983570-51983592 CACCTCACTCTCCTGTCGCTGGG - Exonic
954668100 3:52270365-52270387 CACCTCAGCCTCCCAAAGGTTGG + Intronic
954779674 3:53049802-53049824 CGCCTCAGCCCCGAGTAGCTGGG + Intronic
955079787 3:55648069-55648091 CAGCTGAGCTTCCTGAAGCTGGG + Intronic
955194870 3:56795884-56795906 CACCTCAGCCTCCAAGTGCTAGG + Intronic
955392548 3:58531872-58531894 CAACCCAGCCTCCTGGGGCTGGG + Intronic
955722171 3:61894186-61894208 CGCCTCAGCTCCCAGTAGCTGGG - Intronic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
956150808 3:66240401-66240423 CACCTCAGTCCCAAGTAGCTGGG + Intronic
956506940 3:69951209-69951231 CACCTCAGCCTCCCGTAGCTGGG + Intronic
956799691 3:72745954-72745976 TGCCTCAGCCTCGAGTAGCTGGG + Intergenic
957337555 3:78851056-78851078 CACCTCGGCCTCCCAAAGCTGGG + Intronic
957565286 3:81877456-81877478 TGCCTCAGCCTCCTGTAGCTAGG + Intergenic
958151033 3:89695670-89695692 CTCCCCAGCCCCCTGCAGCTTGG + Intergenic
958516012 3:95116970-95116992 CACCTCAGCCTCCCAAAGCATGG + Intergenic
958539672 3:95454614-95454636 CACCTCAGCCTCTCAGAGCTGGG - Intergenic
958786545 3:98602869-98602891 TGCTTCAGCCTCCTGAAGCTGGG - Intergenic
959293770 3:104509179-104509201 CACCTCAGCCTCCTAGTGTTGGG - Intergenic
959465745 3:106684646-106684668 CACCTCGGCCTCCCAAAGCTGGG - Intergenic
959648295 3:108726898-108726920 AACCTCAGCCTCCTATAACCCGG - Intergenic
960299373 3:115983405-115983427 CACCTCAGCCTCAAGTAGCTGGG - Intronic
960467427 3:118014459-118014481 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
960539063 3:118844468-118844490 CTCCTCTTCCTCCCGTAGCTTGG - Intergenic
960805788 3:121582817-121582839 CACCTCAGCCTCCCATAGCTGGG + Intronic
960995942 3:123340174-123340196 CACCTCAGCTCCCAGTAACTCGG - Intronic
961481541 3:127183882-127183904 CACCTCAGCCTCCTGAATGATGG + Intergenic
961759757 3:129157972-129157994 TGCCTCAGCCTCAAGTAGCTGGG + Intronic
961843045 3:129734567-129734589 CACCTCAGCCTCAAGTAGCTGGG - Intronic
962289634 3:134123233-134123255 GTCCTCAGCCTCCTGCAGCAGGG + Intronic
962400524 3:135055472-135055494 CACCTTATCTTCCTGTACCTTGG - Intronic
962552797 3:136512190-136512212 TGCCTTAGCCTCCTGAAGCTGGG - Intronic
962780020 3:138705033-138705055 CACCTCAGCCTCAAGCAGATGGG + Intronic
963196530 3:142537202-142537224 TGCCTCAGCCTGCAGTAGCTAGG + Intronic
963206462 3:142641044-142641066 CACCTCAGCCTCTCAAAGCTAGG - Intronic
963531012 3:146473419-146473441 TACCTCAGCCTCCCATAGTTGGG + Intronic
963757007 3:149245230-149245252 TACCTCAGCCTCCCGTAGCTAGG + Intergenic
963916392 3:150862437-150862459 CACCTCAGCATCCTGGAACTGGG - Intergenic
963926610 3:150957770-150957792 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
964821605 3:160776714-160776736 TGCCTCAGCCTCCTGTAACTGGG + Intronic
965096346 3:164232145-164232167 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
965179369 3:165382238-165382260 TTCCTTAGCCTCCTGTAGCTGGG + Intergenic
965725340 3:171710174-171710196 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
965801836 3:172502474-172502496 CACCTCAGCCTCCTGAGTCATGG + Intergenic
965815130 3:172628401-172628423 TGCCTCAGCCTCCAGTAGCTGGG - Intergenic
966276184 3:178172870-178172892 CACCTCAGCCTCCCAGTGCTGGG - Intergenic
966646346 3:182249852-182249874 TGCCTCAGCCTCGAGTAGCTGGG - Intergenic
966810867 3:183843399-183843421 CACCTCAGCCCCCAGGAGCTGGG - Intronic
966964677 3:184978646-184978668 CACCTCAGCCTCCCAAAGCTGGG + Intronic
967307248 3:188070828-188070850 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
967692734 3:192495778-192495800 CAACTCAGCCTCGAGTAGTTGGG + Intronic
968110704 3:196044476-196044498 CACCTCAGCCTCGAGTTGCTGGG - Intronic
968578392 4:1378435-1378457 CGCCTCAGTCTCGAGTAGCTGGG - Intronic
968799045 4:2730016-2730038 CACCTCAGCCCCGAGCAGCTGGG + Intronic
968811645 4:2802278-2802300 TGCCTCAGCCTCCTATAGCTGGG - Intronic
968860874 4:3168760-3168782 CACCTCAGCCCCGAGTAGCTGGG - Intronic
969263050 4:6045754-6045776 TGCTTCAGCCTCCTGCAGCTGGG - Intronic
969357058 4:6634734-6634756 TGCTTCAGCCTCCTGTAGCTGGG - Intergenic
970240163 4:14001049-14001071 CACCTCATCCTGCTACAGCTGGG + Intergenic
970256603 4:14175132-14175154 CACCCCAGCCTCTTATATCTCGG - Intergenic
970585897 4:17513936-17513958 AGCCTCAGCCTCCAGTAGCTGGG + Intergenic
970862070 4:20715749-20715771 TGTCTCAGCCTCCTGAAGCTGGG - Intronic
970888660 4:21016724-21016746 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
971033982 4:22673100-22673122 TGCCACAGCTTCCTGTAGCTAGG - Intergenic
971323728 4:25626967-25626989 CACCTCAGCCTCCCAAAGCACGG - Intergenic
971750275 4:30638242-30638264 TGCTTCAGCCTCCTGAAGCTGGG - Intergenic
973852685 4:54976935-54976957 CACTTCAGCCTGCAGTAGCGAGG - Intergenic
973896751 4:55421412-55421434 CACCTCAGCCTTCTGAGTCTGGG + Intronic
973955201 4:56056677-56056699 CACCTCAGCCCCAAGTAACTGGG - Intergenic
974060322 4:57027419-57027441 CATCTCAGCCTCAAGTAGCTGGG + Intronic
974439538 4:61898730-61898752 TGCCTCAGCTTCCTGAAGCTGGG + Intronic
974625745 4:64427383-64427405 CACCTCGGCCTCCTGTAACTGGG + Intergenic
974676258 4:65093180-65093202 TGCCTCAGCCTCCTGTACTTTGG + Intergenic
974717713 4:65691857-65691879 TGCCTCAACCTCCTGTAGCTGGG - Intergenic
975123066 4:70750125-70750147 TACCTCAGCCCCGAGTAGCTAGG + Intronic
975491778 4:74997068-74997090 CATGTCAGCCTGGTGTAGCTAGG - Intronic
975536682 4:75458825-75458847 CACCTCAGCCTCCTGAATACTGG + Intergenic
975658716 4:76667430-76667452 CACCTCAGCCCTGAGTAGCTGGG + Intronic
976196836 4:82540361-82540383 CACCTCAGCCTCCTAAAGTGCGG + Intronic
976240656 4:82953102-82953124 CATCTCAGCCTCCTGTAGGTGGG + Intronic
976413894 4:84749003-84749025 CACCTTAGCCTCCAGTAGGTAGG + Intronic
976586141 4:86799443-86799465 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
976610365 4:87024702-87024724 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
976725290 4:88210301-88210323 CACCTCAGCCTCCAGTGGCTGGG + Intronic
976753220 4:88471587-88471609 CACCTCAGCCTCCTGGTGTTGGG + Intronic
976778274 4:88730504-88730526 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
976782397 4:88775453-88775475 CACCTCAGCCTCCCAGTGCTGGG - Intronic
976790980 4:88878172-88878194 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
977087537 4:92621545-92621567 CACCTCAGCTTCCTATAGCTGGG - Intronic
977199276 4:94096756-94096778 CACCTCAGCCTCCTGGGGCCTGG + Intergenic
977599747 4:98923427-98923449 CATTTCAGCCTCCTGAGGCTAGG + Intronic
977601038 4:98933849-98933871 CACCTCAGCCTCCTGAACGATGG + Intergenic
977604691 4:98971780-98971802 TGACTCAGCCTCATGTAGCTGGG + Intergenic
977900624 4:102418120-102418142 CACCCTAGCCTCCTGAGGCTGGG - Intronic
978114621 4:105004458-105004480 CACCTCAGCCTCCTAAAGTGTGG - Intergenic
978237854 4:106481675-106481697 CCCGTCAGGCTCCTGGAGCTAGG - Intergenic
978335014 4:107657605-107657627 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
978361843 4:107939045-107939067 TGCCTCAGCCTCGAGTAGCTGGG - Intronic
978441837 4:108741462-108741484 CGCCTCAGCCTCCTAGTGCTGGG - Intergenic
978534347 4:109745304-109745326 CCCCTCAACCTCCAGGAGCTGGG + Intronic
978593405 4:110351142-110351164 TGCCTCAGCTTCATGTAGCTGGG - Intergenic
979535544 4:121816069-121816091 TGCCTCAGCCTCGAGTAGCTGGG + Intronic
980316210 4:131204313-131204335 CGCCTCGGCCTCCCATAGCTGGG - Intergenic
980722502 4:136716816-136716838 CACCCCCACCTCCTGTTGCTCGG + Intergenic
980843301 4:138293120-138293142 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
981266026 4:142784285-142784307 CACCACAGCCTCCTCTTCCTGGG - Intronic
982027371 4:151264180-151264202 CACCTCAGCCTCCCAAAGCTGGG - Intronic
983249859 4:165331188-165331210 CACCTCAGCCCCTCGTAGCTGGG - Intronic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
983281815 4:165690391-165690413 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
983510070 4:168599648-168599670 TGCCTCAGCCTCCAGTAGCTAGG - Intronic
983556672 4:169065252-169065274 AGCCTCAGCCTCCTGTAGCTGGG - Intergenic
983556760 4:169066032-169066054 CACCTCAGCCTCCTAAAGTGCGG - Intergenic
983946762 4:173594947-173594969 TGCCTCATCCTCCTGTAGCTGGG + Intergenic
984183941 4:176519531-176519553 CACCTCAGTCTCAAGTAGATGGG - Intergenic
984553138 4:181184319-181184341 CACCTCAGCCTTCTGAAGAGGGG - Intergenic
984612673 4:181858198-181858220 CACCTCAGCCTCCTGAATTTTGG + Intergenic
984675302 4:182540471-182540493 TGCCTCCGCCTCCCGTAGCTGGG - Intronic
984686567 4:182675291-182675313 CACCTTGGCCTCCTGGTGCTGGG - Intronic
984799115 4:183696643-183696665 CACCTCAGCCTCCCAAAGCTGGG + Intronic
984978733 4:185256737-185256759 CACCTCAGCCCCAAGTAGCTGGG + Intronic
985010037 4:185573106-185573128 CACCTCAGCCTCCTGTCAGCTGG + Intergenic
986141508 5:5034720-5034742 CACATCAGCCCCTAGTAGCTGGG - Intergenic
986378498 5:7159415-7159437 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
987124657 5:14800838-14800860 CACCTCAGCCTCGGGTAGCTGGG + Intronic
987335011 5:16891171-16891193 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
987368225 5:17169108-17169130 TGCCTCAGCTTCCAGTAGCTGGG - Intronic
988578743 5:32450685-32450707 TACCTCAGCCTCCTGTAGCTGGG - Intergenic
989047283 5:37285204-37285226 CGCCTCAGCTCCCTGTAGCTGGG - Intergenic
989305419 5:39949611-39949633 TGCCTCAGCTTCCCGTAGCTGGG - Intergenic
990577422 5:57136624-57136646 CACCTCAGCCTCCCAAAGTTTGG - Intergenic
991087883 5:62664918-62664940 TACCTCAGCCTCGAGTAACTGGG - Intergenic
991685121 5:69174631-69174653 AACCTCCGCCTCCAGTAGCTGGG - Intronic
991696575 5:69278812-69278834 CACCTCTGTCCCCAGTAGCTGGG + Intergenic
991907517 5:71526799-71526821 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
991979926 5:72220181-72220203 CACCTTGGCCTCATGTACCTGGG + Intronic
992075682 5:73190752-73190774 CACACCAGCCTCCTGTGACTAGG + Intergenic
992617453 5:78558588-78558610 CACCTCAGCCTCCTGAATACTGG + Intronic
992694898 5:79276537-79276559 TGCCTCAGCCTCCCATAGCTGGG + Intronic
992759288 5:79937409-79937431 TGCCTCAGCCTCCTGTAGATGGG + Intergenic
992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG + Intergenic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
994092309 5:95820235-95820257 CACCTCAGCCTCCCGTGGCTGGG - Intronic
994189030 5:96846988-96847010 CATCTCAGCCTCCCAAAGCTAGG - Intronic
994205812 5:97034182-97034204 CACCCCATCCTCCTGGAGATAGG - Exonic
994785436 5:104155335-104155357 CACCTCAGTCTCCTAAAGCCTGG + Intergenic
995138499 5:108706086-108706108 AACCTCCACCTCCTGGAGCTGGG + Intergenic
995171890 5:109124111-109124133 CACCTCAGCCTTTTGTAGCTGGG - Intronic
995234968 5:109818252-109818274 TGCCTCAGCCTCCTGTAACTGGG + Intronic
995340998 5:111059403-111059425 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
995590117 5:113690612-113690634 TGCCTCAGCCTCCTGTCACTGGG - Intergenic
995859623 5:116627851-116627873 CAGGTCAGCCTCCTGGAGCCTGG - Intergenic
995873894 5:116770212-116770234 CATTTCAGCCACCTATAGCTGGG - Intergenic
996594108 5:125181834-125181856 TACCTCAGCCTCCTGAAGTGTGG + Intergenic
996728376 5:126692862-126692884 CACCTCAGCCCCAAGTAGCTGGG + Intergenic
997326184 5:133023655-133023677 TGCCTCAGCCTCCTTTAGCTGGG - Intronic
998153992 5:139774072-139774094 CACCTCAGCCTCCTAAAGTGTGG + Intergenic
998195798 5:140069709-140069731 TACCTCAACCTTCAGTAGCTGGG - Intergenic
998221017 5:140279575-140279597 CGCTTCAGCCTCCCGTAGCTGGG + Intronic
998444671 5:142189322-142189344 CGCCTCAGCCTCTAGTAGCTGGG - Intergenic
998480086 5:142455637-142455659 CATCACAGCCTTCTGGAGCTTGG - Intergenic
998555939 5:143123740-143123762 CACCTCAGCCTCCCATAGCTAGG - Intronic
998608200 5:143658789-143658811 CACCCCAGCCTCCCAAAGCTGGG + Intergenic
998839834 5:146241572-146241594 TGCCTCAGCCTCAAGTAGCTGGG + Intronic
998864128 5:146477809-146477831 CACCTCAGCCCTGAGTAGCTGGG + Intronic
999159116 5:149480617-149480639 CACGACATTCTCCTGTAGCTGGG - Intergenic
999225195 5:150016225-150016247 CACCTCAGCCCTGAGTAGCTGGG - Intronic
999302741 5:150501254-150501276 CTCCTCTGCCTCCTCTTGCTGGG + Intronic
1000069860 5:157730390-157730412 CACCTCATCCTCCCATAGCTAGG + Intergenic
1000445210 5:161310874-161310896 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1000475312 5:161699708-161699730 CACCTCCGCCTCCCAAAGCTGGG + Intronic
1001069248 5:168569934-168569956 TGCCTCAGCCTCCTGTAACTGGG - Intronic
1001508466 5:172299143-172299165 CACCTCAGCACCAAGTAGCTAGG + Intergenic
1001605119 5:172954317-172954339 CACCTCAGCCTCCCGGTGCTGGG - Intergenic
1001607642 5:172973946-172973968 CACCTCAGCCTCCCAGAACTGGG + Intergenic
1001745253 5:174087672-174087694 CACCTCAGCCTCCTGCAAGTAGG - Intronic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1002020088 5:176358598-176358620 TGCCTCAGCCTCGAGTAGCTGGG - Intronic
1002027853 5:176407550-176407572 CACCTCAGCCTCCCACTGCTGGG + Intronic
1002172100 5:177380928-177380950 CACCTCAGCCTCCAAGTGCTGGG + Intronic
1002494236 5:179600944-179600966 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1003003578 6:2360150-2360172 CATCTCAGCTTCCCGTGGCTTGG + Intergenic
1003208352 6:4035849-4035871 CGCCTCAGCCTTGAGTAGCTGGG - Intronic
1003264348 6:4552362-4552384 CTCCTCAGCCTACTCCAGCTTGG + Intergenic
1003400978 6:5790537-5790559 CACCTCTGCCTCCTGGAGCAAGG - Intergenic
1003573366 6:7270514-7270536 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
1003605289 6:7554272-7554294 CAGCACAGCCTACTGTAGTTTGG - Intronic
1003678044 6:8225195-8225217 CACCTCAGCCTCCCATTGCTGGG + Intergenic
1004415277 6:15417626-15417648 CATCTCACCCTCCTGTAACTGGG - Intronic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1004516062 6:16323268-16323290 CGCCTCAGCCTCCTAAAGCTGGG - Intronic
1004573196 6:16867901-16867923 TACCTCAGCGTCCTGGAGCTGGG - Intergenic
1005082468 6:21970561-21970583 CGTCTCAGCCTCCTGTAGCTGGG + Intergenic
1005103735 6:22200972-22200994 CACCTCAGCCTCCCAAAGCTAGG + Intergenic
1005287731 6:24346637-24346659 TGCCTTAGCCTCCAGTAGCTGGG - Intronic
1005437719 6:25832817-25832839 CACTTCAGCCCCAAGTAGCTGGG + Intergenic
1005636969 6:27762042-27762064 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1005732083 6:28707667-28707689 CCTCTCTGCCTTCTGTAGCTGGG - Intergenic
1006530966 6:34653472-34653494 CACCTCGGCCTCCCAAAGCTGGG + Intronic
1006626099 6:35398997-35399019 CACCTCAGACTCCCATAGCTGGG - Intronic
1006641961 6:35494342-35494364 AACCTCAACCTCCTGTGGGTCGG + Intronic
1006907270 6:37541116-37541138 TGCCTCAGCTTCCCGTAGCTGGG - Intergenic
1006963732 6:37960959-37960981 CACCTCAGCCTCCTGACTATAGG - Intronic
1007011741 6:38424950-38424972 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1007409425 6:41653395-41653417 CACCTGTGGCTCCTGCAGCTCGG + Exonic
1007518656 6:42433907-42433929 TGACTCAGCCTCCCGTAGCTGGG - Intronic
1007586824 6:42995827-42995849 CCCCTCAGCCCCGAGTAGCTGGG + Intronic
1007595529 6:43048879-43048901 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1008758884 6:54830490-54830512 CACCTCATCCTCATGATGCTTGG + Intergenic
1008954416 6:57199271-57199293 CACCTCAGCCTCCCTTTGGTGGG + Intronic
1009301010 6:62020750-62020772 CACCCCAGCTTCCTGTTGATTGG + Intronic
1010100979 6:72108131-72108153 TACCTCACCCTTCTGTAACTGGG + Intronic
1010440252 6:75885560-75885582 TGCCTCAGCCTCCCATAGCTGGG + Intronic
1010685242 6:78846800-78846822 CACTTCAGCCTGCAGTTGCTTGG - Intergenic
1011012836 6:82721544-82721566 CATCTCAGCATCCCGTAGCTAGG - Intergenic
1012193761 6:96314071-96314093 CACCTCAGCCTCCCAAAGTTTGG + Intergenic
1012496520 6:99839225-99839247 CACCTCAGTCCCAAGTAGCTGGG - Intergenic
1013154258 6:107477978-107478000 CACCTCCCCCTCAGGTAGCTGGG - Intergenic
1013272300 6:108556581-108556603 CACCTCGGCCTCCCATAGCTGGG + Intergenic
1013354285 6:109333581-109333603 AACCTCAGCCTCCTGAAGCTAGG + Intergenic
1014226105 6:118848806-118848828 TGTCTCAGCCTCCTGAAGCTGGG - Intronic
1015303871 6:131684429-131684451 CACCTCAGCCTCCTAAAGTGCGG - Intronic
1015996622 6:139000962-139000984 TGCCTCAGCCTCAAGTAGCTGGG - Intergenic
1016282016 6:142429269-142429291 AACCTCAGCCTCCAGTGGCAAGG - Intronic
1016819862 6:148337170-148337192 AGCCTCAGCCTCCCATAGCTGGG + Intronic
1017438087 6:154436599-154436621 CATCTCAGCCTCTAGTAGCTGGG + Intronic
1017450343 6:154548984-154549006 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
1017512459 6:155126481-155126503 CACCTCAGCCTCCCAAAGCGCGG - Intronic
1017610943 6:156185673-156185695 CACCTCAGCCTCCCAAAGTTTGG + Intergenic
1017872293 6:158496959-158496981 CACCTCAGCCTGTACTAGCTAGG + Intronic
1017941638 6:159058394-159058416 TTCCTCAGCCTCCTATAGCTGGG + Intergenic
1018046632 6:159970962-159970984 CACCTCAGCCTCCCTTAACTGGG - Intronic
1018318470 6:162581643-162581665 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
1018403017 6:163445020-163445042 CACCTCAGTCTTGAGTAGCTGGG + Intronic
1018935109 6:168269165-168269187 TCCCTCACCCTCCTGGAGCTTGG - Intergenic
1019207271 6:170372714-170372736 CTCCTCAGCCTCCTTTAGCAGGG - Intronic
1019767043 7:2859139-2859161 AGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1019801353 7:3090651-3090673 CACCTCAGCCTCCTAAAGTACGG + Intergenic
1019807879 7:3141931-3141953 CACCTCAGCCTCCTGAGGCTGGG - Intronic
1019883518 7:3884192-3884214 CACCTCAGCCTCCGAAAGCATGG + Intronic
1019890471 7:3942020-3942042 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1020034562 7:4957229-4957251 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
1021806584 7:24362846-24362868 TGCCTCAGCCTCAAGTAGCTGGG + Intergenic
1021935742 7:25629817-25629839 GACCTCAGCCTCCAGAACCTAGG + Intergenic
1022224692 7:28350779-28350801 CAGCTCTGCCTTCTGCAGCTTGG - Intronic
1022273294 7:28831468-28831490 CGCCTCAGTCTCAAGTAGCTGGG + Intergenic
1022946948 7:35295484-35295506 CACCTCAGCCTCCAGAATCGCGG - Intergenic
1023297972 7:38736413-38736435 CACTTCAGCTTTCTGGAGCTTGG - Intronic
1023760813 7:43463735-43463757 CACCTCCGCCTCCTCCTGCTGGG - Exonic
1023925577 7:44667058-44667080 CACCCCAACCTCTTGTATCTGGG + Intronic
1024243001 7:47449719-47449741 TGCCTCAGCCTCCAGTAGTTGGG + Intronic
1025040781 7:55643547-55643569 TGCCTCAGCCTCCTATAGCTGGG + Intergenic
1025070264 7:55892162-55892184 AGCCTCAGCCTCCTGTAGCTGGG - Intronic
1025619714 7:63157447-63157469 CACCTCAGCCTCAAGTAGCTGGG - Intergenic
1025762207 7:64405344-64405366 TGCCTCAGGCTCCTGTAGCTGGG + Intergenic
1025970029 7:66314397-66314419 CACCTCAGCCTCCTGCAGCTGGG - Intronic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1026313648 7:69209670-69209692 CACCTCAGCCTCCCAAAGCATGG - Intergenic
1026437651 7:70413788-70413810 CTACTCAGCCTCAAGTAGCTGGG + Intronic
1026517221 7:71083376-71083398 AGCCTCAGCCTCCTGGAGCCAGG + Intergenic
1026530755 7:71195327-71195349 CGCCTCAGTCTCCTATAGCTGGG + Intronic
1026530779 7:71195493-71195515 TACCTGAGTCTCCTATAGCTGGG + Intronic
1026699281 7:72625546-72625568 CACCTCAGCCTCCCGCTCCTGGG - Intronic
1026818685 7:73531893-73531915 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
1027249415 7:76389697-76389719 CCCCTGAGCCTCCTGGATCTAGG + Exonic
1027493086 7:78855200-78855222 CACCTCAGCCCCAAGTAGCTGGG + Intronic
1027674902 7:81145079-81145101 TGCCTCAGTCTCCCGTAGCTTGG - Intergenic
1028569294 7:92268589-92268611 CACCTCAGGCTCCCGTAGCTGGG + Intronic
1028926016 7:96357870-96357892 CACCTCAGCCTCCGGAAGCTGGG + Intergenic
1028996139 7:97102251-97102273 CACCTCGGCCTCCCAAAGCTGGG + Intergenic
1029212172 7:98918004-98918026 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
1029247088 7:99209890-99209912 CACCTCAGCCTCAAGTAGCTGGG - Intergenic
1029498576 7:100912642-100912664 CACCTCAGCCTCCCAATGCTGGG - Intergenic
1029793293 7:102867814-102867836 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1030014168 7:105201729-105201751 CATCTCAGCCTCCTGAGTCTTGG - Intronic
1030109499 7:106014505-106014527 CATCTCAGCCTCAAGTAGTTGGG - Intronic
1030186746 7:106769856-106769878 CACCTCAGCCCCGAGTAGCTGGG - Intergenic
1030683042 7:112452274-112452296 CTCCTCAGCCTCCTGTAGCTAGG + Intronic
1030940746 7:115646114-115646136 CACCTCAGCCTCTTGAAGCTGGG - Intergenic
1031082967 7:117276167-117276189 CATCTCAGCTTCCTTTAGTTTGG - Intergenic
1031999007 7:128252615-128252637 CATCTCAGCCTCCCCTAGCTGGG - Intronic
1032380394 7:131473898-131473920 CACCTCAGCCTCCTGAAGTGCGG - Intronic
1032390126 7:131550404-131550426 CACCTCAGCCTCCCAGTGCTAGG - Intronic
1032960880 7:137032801-137032823 CATCTCATCCTCCAGGAGCTGGG - Intergenic
1032992099 7:137405356-137405378 TGCCTCAGCCTCAAGTAGCTGGG + Intronic
1033209266 7:139448577-139448599 TGCCTCAGCCTCGAGTAGCTGGG - Intergenic
1033779238 7:144650156-144650178 CACCCCAGTCTTCTTTAGCTAGG - Intronic
1034151829 7:148922779-148922801 TGCCTTAGCCTCCAGTAGCTGGG - Intergenic
1035012042 7:155727877-155727899 CACCGCAGCCTCAAGTAGCTGGG + Intronic
1035449724 7:158968865-158968887 CACCCCAGCCCCGAGTAGCTGGG - Intergenic
1035459480 7:159030227-159030249 TGCCTCAGCCTCCCATAGCTGGG - Exonic
1036147746 8:6270226-6270248 TGCCTCAGCCTCCAGTAGCTGGG - Intergenic
1036388857 8:8307274-8307296 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1036652163 8:10651609-10651631 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1037312514 8:17571761-17571783 CACCTTAGCCCCGAGTAGCTGGG - Intergenic
1038290989 8:26249761-26249783 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1038307472 8:26417610-26417632 TGCCTCAGCCTCCTGTACCAGGG - Intronic
1038469938 8:27806730-27806752 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1038576711 8:28710674-28710696 CACCTCAGCCTCTAGTAGCTGGG + Intronic
1038917472 8:32039906-32039928 CACCTCAGCCCCAAGTAGCTTGG - Intronic
1039009388 8:33075899-33075921 AAGCTCATCCTCCTGCAGCTGGG + Intergenic
1039322132 8:36443800-36443822 CACCTCAGCCTCCCAAAGCATGG + Intergenic
1039323348 8:36457408-36457430 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
1039851854 8:41374985-41375007 CACCTCAGCCTCCCAAAGTTGGG - Intergenic
1039966154 8:42285439-42285461 CACCTCAGCTTCAAGTAGCTGGG - Intronic
1040427838 8:47307332-47307354 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
1040517861 8:48148950-48148972 AACCTCAGCCCCGAGTAGCTGGG - Intergenic
1040743056 8:50604300-50604322 CACCTCAGCCCCCTGTAGCTGGG - Intronic
1041236251 8:55805766-55805788 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1041675776 8:60537926-60537948 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1041686495 8:60649486-60649508 TGCATCAGCCTCCTGTAGCTGGG - Intergenic
1042214425 8:66415889-66415911 CGCCTCAGCCTCCTGAAGTGTGG - Intergenic
1042238812 8:66641473-66641495 CACCTCAGCCTCCCAGTGCTGGG + Intronic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1042598481 8:70474237-70474259 TGCCTCAGCTTCCTGTAGCTGGG + Intergenic
1042649876 8:71027883-71027905 CACCTCGGCCTTCAGTAGCTGGG + Intergenic
1042778528 8:72464157-72464179 TGCCTCAGCCTCCAGTAGCTGGG + Intergenic
1042829954 8:73016002-73016024 CACCTCAGCCTCCCAGAGCTGGG - Intronic
1043475343 8:80600338-80600360 CACCTCAGTCCCCTGTAGCTGGG + Intergenic
1043477996 8:80623744-80623766 TGCCTCAGCCTTCCGTAGCTGGG - Intergenic
1043975768 8:86583015-86583037 AACCTCTGCTTCCTGTAGCTGGG + Intronic
1043978900 8:86615352-86615374 CACCTCAGCCTCCAAAATCTGGG - Intronic
1044690386 8:94871216-94871238 CATCTCAGCCTCCCGGTGCTGGG - Intronic
1044713808 8:95081948-95081970 CGCTTCAGCCTCCCATAGCTGGG - Intronic
1044734721 8:95268360-95268382 CACCTCGGCCTACCCTAGCTGGG - Intronic
1044860615 8:96519747-96519769 TGCCTCAACCTCCTGTAGCTGGG + Intronic
1044937893 8:97310639-97310661 CACCTCAGCCTCCAAGTGCTGGG + Intergenic
1044963830 8:97556664-97556686 TGCCTCAGCCTCATGTAGCTGGG - Intergenic
1044993791 8:97819981-97820003 CACCTCGGCCTCCCAAAGCTGGG + Intronic
1044999523 8:97868291-97868313 CACCCCAGCCTCCAGGAACTGGG + Intergenic
1045179333 8:99763020-99763042 CACTTCAGCCCCAAGTAGCTGGG - Intronic
1045308845 8:100982860-100982882 CACCTCAGCCTCCCAACGCTGGG - Intergenic
1045400318 8:101809658-101809680 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1045563881 8:103294171-103294193 CAGCCCAGCCTCCTCCAGCTGGG + Intergenic
1045869329 8:106907400-106907422 TGCCTCAGCCTCCAGCAGCTGGG + Intergenic
1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG + Intergenic
1046652840 8:116857857-116857879 CACTTCAGCCTCAAGTAGCTGGG - Intronic
1046997660 8:120542403-120542425 CACCTCAGCCTCCAAAAGCTGGG - Intronic
1047295447 8:123566800-123566822 CAACTCAGCCTCCTGGAGGGTGG + Intergenic
1047742461 8:127817776-127817798 CATCTCAGCCTCTAGTAGCTGGG - Intergenic
1048017851 8:130513380-130513402 CACCTCAGCCTCCCAAGGCTGGG - Intergenic
1048638939 8:136331200-136331222 CACCTCAGCCTCCTGCTGGCTGG - Intergenic
1048685105 8:136896150-136896172 CACCTCAGCCTCCTGAGAGTTGG + Intergenic
1048818882 8:138361174-138361196 CTCCTCAGCCTCCCAAAGCTGGG + Intronic
1049430520 8:142561087-142561109 CACCTCAGCCTCCTAAAGTGTGG + Intergenic
1049568038 8:143352738-143352760 CACCTCAGCTTACCATAGCTGGG + Intronic
1049705077 8:144038011-144038033 TGCCTCAGCCTCGCGTAGCTGGG - Intronic
1049871565 8:144982694-144982716 TTCCTCAGCCTCCAGTAGCTGGG - Intergenic
1049981129 9:904826-904848 TGCCTCAGCCTCGAGTAGCTGGG - Intronic
1051577496 9:18633473-18633495 TGCCTCAGCCTCAAGTAGCTGGG - Intronic
1051670664 9:19506602-19506624 TGCCTCAGCCTCCAGTAGCTGGG + Intergenic
1051964526 9:22811463-22811485 TGCCTCAGCCTCCAGGAGCTGGG + Intergenic
1052456414 9:28705028-28705050 CACCTCAGCCTCCTGTATCTGGG + Intergenic
1052888889 9:33677173-33677195 CACCTCCCCCTCCTGGAGCGGGG - Intergenic
1052976086 9:34411297-34411319 TGCCTCAGCCTCATGTAGCTAGG - Intronic
1053130255 9:35610461-35610483 CTCCACAGCCTCCAGTTGCTTGG - Intronic
1053201685 9:36156271-36156293 CACGTCAGCCTCCTGTAACCAGG - Intronic
1053356837 9:37453299-37453321 CACCTCAGCCTCCCGTTGGCTGG + Intronic
1053440617 9:38113157-38113179 TGCCTCAGCCTCGAGTAGCTAGG - Intergenic
1053707921 9:40773710-40773732 CACCTCAGCCTAGAGTAGCTGGG + Intergenic
1053796970 9:41735409-41735431 AACCTCAGCTTCCCATAGCTGGG + Intergenic
1054148222 9:61579447-61579469 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1054185383 9:61947491-61947513 AACCTCAGCCTCCCATAGCTGGG + Intergenic
1054417831 9:64894499-64894521 CACCTCAGCCCAGAGTAGCTGGG + Intergenic
1054467966 9:65510555-65510577 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1054653126 9:67641007-67641029 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1055151761 9:73009221-73009243 CACCTCAGCCTCGAGTAGTTGGG + Intronic
1055407941 9:75994536-75994558 TGCCTCAGCCTCCCGAAGCTGGG + Intronic
1055483367 9:76732196-76732218 TGCCTCAGCCCCCAGTAGCTGGG - Intronic
1055660501 9:78498809-78498831 TGCCTCAGCCTCCAGTAGCTGGG - Intergenic
1056103651 9:83325438-83325460 CACCTCAGCCTCCTATAGCTAGG + Intronic
1056162604 9:83911655-83911677 CGCCTCAGCCTCCAGTAGCTGGG + Intronic
1056357744 9:85819873-85819895 CGCCTCAGCCTCCAGCAGCTGGG - Intergenic
1057389923 9:94634178-94634200 TGCCTCAGCCTCCCATAGCTGGG - Intronic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1058015184 9:100023693-100023715 CGCCTCAGCCTCCCAAAGCTGGG + Intronic
1058242431 9:102582504-102582526 TGCCTCAGCCTCAAGTAGCTGGG + Intergenic
1058436127 9:104965120-104965142 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1058469645 9:105264275-105264297 CACCTCAGCCTCCTGAATAGCGG + Intronic
1058789669 9:108430121-108430143 CACCTCAGCCTCCAGTAGCTTGG - Intergenic
1058964144 9:110020857-110020879 CACCTCAGCCTCCCAGTGCTTGG - Intronic
1059173795 9:112151046-112151068 TGCCTCAGCCTCCTGGGGCTAGG + Intronic
1059183604 9:112244174-112244196 TGCCTCAGCCTCCCGAAGCTGGG - Intronic
1059287521 9:113187877-113187899 CACCTCAGCCATCTGTTACTGGG - Exonic
1059314433 9:113411790-113411812 CACCTCAGCCCCAAATAGCTGGG + Intronic
1060274556 9:122172561-122172583 CAGCTCAACGTCCTGAAGCTGGG + Intronic
1060299039 9:122363276-122363298 CGCCTCAGCCTCCCTGAGCTGGG + Intergenic
1060746512 9:126137292-126137314 CACCTCAGCCTCCTATAACTGGG + Intergenic
1060907571 9:127321245-127321267 TGCCTCAGCCTCTAGTAGCTGGG + Intronic
1060989545 9:127840478-127840500 TGCCTCAGACTCCTGTAGCTGGG - Intronic
1061553585 9:131352091-131352113 TGCCTCAGCCTCCCGTAGGTGGG - Intergenic
1061624619 9:131834480-131834502 CACTTCTGCCTCCTGTCTCTTGG + Intergenic
1062088006 9:134658526-134658548 CACCTCCCCTTCCTGCAGCTAGG + Intronic
1062453332 9:136624624-136624646 CTCCTCAGCCCCCTGGAGCTGGG + Intergenic
1062477643 9:136736600-136736622 CACCTCAGCCTCCTGAGGAGCGG + Intergenic
1185731627 X:2466360-2466382 CACCACAACCTCCTGTTCCTGGG - Intronic
1185734740 X:2488288-2488310 GGCCTCAGCCTCCAGAAGCTGGG + Exonic
1185850750 X:3484169-3484191 CACCTCAGCCTCCCATAACTGGG + Intergenic
1186361300 X:8844974-8844996 TGTCTCAGCCTCCCGTAGCTGGG - Intergenic
1187318429 X:18219790-18219812 CACCTCAGCCTCCTGAGGAGCGG - Intronic
1187525592 X:20051434-20051456 CACTTCAGCCTCAAGTAGCTGGG - Intronic
1187690495 X:21861588-21861610 CACCTCAGCCTCCTAAAATTTGG - Intronic
1187865533 X:23719948-23719970 TGCCTCAGCCTCCCATAGCTGGG + Intronic
1188077305 X:25794034-25794056 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
1188111582 X:26200277-26200299 CCACTCAGACTCCTGTTGCTGGG - Intergenic
1188331843 X:28882392-28882414 CACCTCAGCCTCCCAAAGCTGGG - Intronic
1188427721 X:30068111-30068133 CCCCACAGCCACCTGTAGCAGGG - Intergenic
1189340860 X:40203684-40203706 CACCTCAGCCTCCTGAATAGCGG + Intergenic
1189481442 X:41395089-41395111 CACCTCATCCTCAAGTAGCTGGG + Intergenic
1190074232 X:47303880-47303902 CGCCTCAGCCTTCAGTCGCTGGG - Intergenic
1190689468 X:52901385-52901407 CGCCTCAGCCTCCCGAAGCAGGG + Intronic
1190696515 X:52954407-52954429 CGCCTCAGCCTCCCGAAGCAGGG - Intronic
1190742637 X:53300006-53300028 CACCTCAGCCTCCCAAAGTTGGG + Intronic
1190824165 X:54001664-54001686 CACCTCAGACTCCTTTTGCTGGG - Intronic
1190860236 X:54337950-54337972 TGCCTCAGCCTCCTGGAGTTTGG - Intronic
1191244322 X:58213965-58213987 CACCTCAGCCTCCCAGTGCTGGG + Intergenic
1192068764 X:67914933-67914955 CACCTCAGCTTCCCAAAGCTGGG - Intergenic
1192153468 X:68726225-68726247 CCCCTAAGCCTCCTGGGGCTGGG - Intergenic
1192154207 X:68731696-68731718 CATCTCAGCCTCCTGTAGCTAGG + Intergenic
1192345846 X:70304770-70304792 TGCCTCAGCCTCCCATAGCTGGG + Intronic
1192774062 X:74223533-74223555 CACCTCAGCCTCCAAGTGCTGGG + Intergenic
1192977919 X:76306116-76306138 CTCCTGAGCCACCTATAGCTTGG + Intergenic
1193379301 X:80800424-80800446 CACCTCAGCCTCTGATAGCTGGG - Intronic
1194012963 X:88584605-88584627 CACCCCTGCCTCTTGTAGCCAGG + Intergenic
1194730017 X:97441698-97441720 TGCCTCAGCCTCCAGTAGCTGGG - Intronic
1196013047 X:110908565-110908587 TGTCTCAGCCTCCTGAAGCTGGG + Intergenic
1196069653 X:111506796-111506818 TGCCTCAGCCTACAGTAGCTGGG + Intergenic
1196705519 X:118714107-118714129 CACGTCAGCCTCCTACAGATGGG - Intergenic
1196738552 X:119003275-119003297 CACCCCCGCCTCAAGTAGCTGGG + Intronic
1196754056 X:119142659-119142681 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1196950926 X:120875210-120875232 CACCTCAGCCGCCTGATGGTGGG - Exonic
1197329234 X:125133240-125133262 CACCTCAGCCTCCTAAAGGGAGG + Intergenic
1197840382 X:130740150-130740172 CACCTCGGCCTCCCAAAGCTGGG - Intronic
1197927438 X:131661860-131661882 CACCTCAGCCTCAAGTATCTGGG + Intergenic
1198134386 X:133732976-133732998 CACCTCAGCCTCGTAAAGCTGGG + Intronic
1198312511 X:135436042-135436064 CACATCAGCCTCCTCCAGCTGGG - Intergenic
1198459991 X:136853888-136853910 TACCTCAGCCTCCCGTAGCTGGG - Intronic
1199644508 X:149893282-149893304 TGCCTCAGCCTCCTGAATCTGGG - Intergenic
1199769516 X:150965536-150965558 CACCTTAGCCTCCTAATGCTGGG + Intergenic
1200098536 X:153675639-153675661 CGCCTCAGCCTCGAGTAGCTGGG + Intronic
1200159355 X:153997657-153997679 TGCCTCAGCCTCAGGTAGCTGGG - Intergenic
1200232561 X:154451300-154451322 TTCCTCAGCCTCCTGGAGCCAGG - Intergenic
1200234847 X:154463343-154463365 CACCACAGCCTCCTGCACCTGGG - Intronic
1200414079 Y:2890001-2890023 CACCTCAGCCTCCCGAAGTCTGG - Intronic
1200420777 Y:2964913-2964935 CACCTCAGCCTCAAGTAGTTGGG - Intronic
1201226498 Y:11823918-11823940 CACCTCCGCCTCCTGGAGTCTGG + Intergenic
1201914495 Y:19167774-19167796 CACCTCAGCCTCCTGTGTTGGGG - Intergenic
1202343999 Y:23902323-23902345 CACCTCAGCTCCCTGTACCTGGG + Intergenic
1202526769 Y:25767760-25767782 CACCTCAGCTCCCTGTACCTGGG - Intergenic