ID: 1057620020

View in Genome Browser
Species Human (GRCh38)
Location 9:96626534-96626556
Sequence CATCATCTGCAAAGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057620020_1057620025 19 Left 1057620020 9:96626534-96626556 CCCTTCACCCTTTGCAGATGATG No data
Right 1057620025 9:96626576-96626598 TCTTGCTGCTCTATTCACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057620020 Original CRISPR CATCATCTGCAAAGGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr