ID: 1057624099

View in Genome Browser
Species Human (GRCh38)
Location 9:96662095-96662117
Sequence CTGGAGAAGGGTGCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057624091_1057624099 -1 Left 1057624091 9:96662073-96662095 CCACCAGGTAGCTGGAATCACCC No data
Right 1057624099 9:96662095-96662117 CTGGAGAAGGGTGCCACAGTGGG No data
1057624090_1057624099 3 Left 1057624090 9:96662069-96662091 CCTGCCACCAGGTAGCTGGAATC No data
Right 1057624099 9:96662095-96662117 CTGGAGAAGGGTGCCACAGTGGG No data
1057624086_1057624099 16 Left 1057624086 9:96662056-96662078 CCAATATAATCCACCTGCCACCA No data
Right 1057624099 9:96662095-96662117 CTGGAGAAGGGTGCCACAGTGGG No data
1057624092_1057624099 -4 Left 1057624092 9:96662076-96662098 CCAGGTAGCTGGAATCACCCTGG No data
Right 1057624099 9:96662095-96662117 CTGGAGAAGGGTGCCACAGTGGG No data
1057624089_1057624099 6 Left 1057624089 9:96662066-96662088 CCACCTGCCACCAGGTAGCTGGA No data
Right 1057624099 9:96662095-96662117 CTGGAGAAGGGTGCCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057624099 Original CRISPR CTGGAGAAGGGTGCCACAGT GGG Intergenic
No off target data available for this crispr